Phenotypic Mutation 'puny'

• Allele: puny
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 30,712,377 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Ntmt1
• Gene Name: N-terminal Xaa-Pro-Lys N-methyltransferase 1
• Synonym(s): Mettl11a, 2610205E22Rik
• Chromosomal Location: 30,697,838-30,713,045 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality and premature death associated with premature aging, decreased body size and weight, skin thinning, liver degeneration, increased sensitivity to oxidative stress and female infertility. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Histidine changed to Arginine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000035303] [ENSMUSP00000142189] [ENSMUSP00000123140] [ENSMUSP00000141222] [ENSMUSP00000141905] [ENSMUSP00000116760]
• AlphaFold: Q8R2U4
• SMART Domains: Protein: ENSMUSP00000035303; Gene: ENSMUSG00000026857; AA Change: H140R

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_PK	8	223	2.3e-99	PFAM
Pfam:Ubie_methyltran	36	178	2.8e-7	PFAM
Pfam:Methyltransf_2	59	190	3.6e-8	PFAM
Pfam:Methyltransf_18	61	168	1.5e-9	PFAM
Pfam:Methyltransf_25	65	161	2.4e-8	PFAM
Pfam:Methyltransf_12	66	163	5.2e-11	PFAM
Pfam:Methyltransf_11	66	165	4.3e-13	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000041830)
• SMART Domains: Protein: ENSMUSP00000142189; Gene: ENSMUSG00000026857

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_PK	8	118	6.7e-43	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000123140; Gene: ENSMUSG00000026857

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_PK	8	78	1.8e-30	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000141222; Gene: ENSMUSG00000026857

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_PK	8	42	1.7e-7	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000141905; Gene: ENSMUSG00000026857

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_PK	8	42	1.7e-7	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000116760; Gene: ENSMUSG00000026857; AA Change: H140R

Domain	Start	End	E-Value	Type
Pfam:Methyltransf_PK	8	146	8.7e-65	PFAM
Pfam:Methyltransf_11	66	146	4.7e-7	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
  (Using ENSMUST00000152374)
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.8580
• Is this an essential gene?: Possibly nonessential (E-score: 0.396)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-01-05 2:46 PM
• Record Posted: 2018-08-08
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_170592; MGI:1913867

Alleles Listed at MGI

All Mutations and Alleles(36) Gene trapped(33) Targeted(3)

Phenotypic Description

Figure 1. Puny mice exhibited reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The puny phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2859 some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R2859. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. The body weight phenotype was linked to two mutations on chromosome 2: Setx and Ntmt1. The mutation in Ntmt1 was presumed causative, and is an A to G transversion at base pair 30,822,365 (v38) on chromosome 2, or base pair 12,924 in the GenBank genomic region NC_000068 encoding Ntmt1. Linkage was found with a recessive model of inheritance, wherein four variant homozygotes departed phenotypically from 11 homozygous reference mice and 24 heterozygous mice with a P value of 3.673 x 10^-12 (Figure 2).  

The mutation corresponds to residue 568 in the mRNA sequence NM_170592 within exon 4 of 4 total exons.

552 CAGTGGGTGATAGGCCACCTGACGGATCAGCAC 135 -Q--W--V--I--G--H--L--T--D--Q--H-

The mutated nucleotide is indicated in red. The mutation results in a histidine to arginine substitution at amino acid 140 (H140R) in the NTMT1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.995).

Protein Prediction

Figure 3. Domain organization and crystal structure of NTMT1. A. NTMT1 does not have defined domains, regions, or repeats.The puny mutation results in a histidine to arginine substitution at amino acid 140. B. Human NTMT1 in complex with dimethylated fly H2B peptide. UCSF Chimera model is based on PDB 5CVE. Click on the 3D structure to view it rotate.

Ntmt1 encodes N-terminal Xaa-Pro-Lys N-methyltransferase 1 [NTMT1; alternatively, NRMT1 or METTL11A]. NTMT1 does not have defined domains, regions, or repeats. NTMT1 folds as a single domain [Figure 3; PDB:5CVE,(1); PDB:5E2B,(2)]. NTMT1 folds in a canonical S-adenosyl-L-methionine-dependent methyltransferase (SAM-MTase) Rossman fold with a seven-stranded β-sheet sandwiched by five flanking α-helices (1;2). Three helices [two α-helixes (α1 and α2) and one 3₁₀ helix (η1)] from the N-terminus and a pair of β-hairpins insert between β5 and α7 of the core domain. The β-hairpins and N-terminal extension promote substrate specificity (2). NTMT1 cofactors bind NTMT1 in an extended conformation, and a conserved DxGxGxG motif in NTMT1 surrounds the ribosyl and methionyl moieties of the cofactor (2). The carboxylate moiety of the cofactor forms a salt bridge with Arg74, and the ribosyl group stacks with the indole ring of Trp20 (2). The NTMT1 substrate binds to a negatively charged channel of NTMT1 that is connected to the cofactor-binding pocket (2). The substrate peptide inserts into the channel with the α-N-amino group pointing toward the methyl group of the cofactor to accept the methyl transfer (2).

The puny mutation results in a histidine to arginine substitution at amino acid 140 (H140R) in the NTMT1 protein. His140 is within α6.

Expression/Localization

Ntmt1 is ubiquitously expressed (NCBI). NTMT1 expression is often reduced in non-small cell lung carcinoma, breast cancer, glioblastoma, and leukemia [(3-5); reviewed in (6)], but NTMT1 was overexpressed in several colon cancer samples (7;8).

Background

Figure 4. NTMT1-catalyzed methylation. In N-terminal α -methylation, the initiator methionine is cleaved and the exposed α-amino group is mono-, di-, or trimethylated by NTMT1. NTMT1 catalyzes the transfer of a methyl group from the cofactor S-adenosyl-l-methionine (SAM) to the protein target’s (e.g., RCC1) α-amine. Figure modified from Richardson, et al.

NTMT1 functions in N-terminal α-methylation, a highly conserved posttranslational modification that regulates protein-DNA interactions. N-terminal α-methylation is necessary for both accurate mitotic division (i.e., spindle assembly and chromosome segregation), nucleotide excision repair, and signal transduction (9;10). In N-terminal α-methylation, the initiator methionine is cleaved and the exposed α-amino group is mono-, di-, or trimethylated by NTMT1 (Figure 4). NTMT1 catalyzes the transfer of a methyl group from the cofactor S-adenosyl-l-methionine (SAM; alternatively, AdoMet) to the protein target’s α-amine.

NTMT1 target proteins have an N-terminal methylation motif (M)XPK [(Met)[Ala/Pro/Ser]-Pro-Lys] (9). NTMT1 also recognizes (with variable methylation efficiencies) peptides that do not contain the canonical XPK motif (i.e., X is Gly, Phe, Tyr, Cys, Met, Lys, Arg, Asn, Gln or His), indicating potentially broad substrate specificity (11). Several NTMT1 target proteins are listed in Table 1 (1;9-11).

Table 1. Select NTMT1 targets

NTMT1 target protein	Brief Description of target protein	Function of NTMT1-associated methylation	References
RCC1	Guanine nucleotide exchange factor for the Ran GTPase, which functions in nucleocytoplasmic transport, mitosis, and nuclear envelope assembly	Promotes RCC1 binding to chromatin; stabilizes the chromatin interaction during mitosis; ensures proper mitotic division	(10)
SET	Inhibits acetylation of nucleosomes; functions in in apoptosis, transcription, nucleosome assembly and histone chaperoning	Unknown	(9)
RB1	Tumor suppressor	Unknown	(9)
Centromere protein A (CENP-A) and CENP-B	Centromere H3 variants	Promotes binding to centromeric DNA	(12;13)
Damaged DNA-binding protein-2 (DDB2)	Functions in nucleotide excision repair to detect UV-induced DNA damage in chromatin	Promotes DDB2 nuclear localization as well as the ability of DDB2 to form foci at the sites of DNA damage to facilitate nucleotide excision repair	(14)
Poly(ADP-ribose) polymerase 3 (PARP3)	Catalyzes the ADP-ribosylation of proteins during DNA damage repair and mitotic progression	Unknown	(15)
Drosophila H2B	Histone protein	Putatively stabilizes chromatin and/or stabilizes H2B	(16)

NTMT1 also functions as a tumor suppressor in breast cancer cells; loss of NTMT1 expression sensitizes cells to DNA damage and causes increased proliferation, cell invasion, and migration (6;17). Conversely, NTMT1 putatively functions as an oncogene in colon cancer (7;8). Mutations in NRMT1 have been identified in lung cancer (Q144H), endometrial cancer (N209I), and lung cancer (P211S) (1).

Most Ntmt1-deficient mice (Ntmt1^{tm1(NCOM)Mfgc/tm1(NCOM)Mfgc}) exhibit premature death by approximately three months of age; 40% of the mice die by one month of age (18). The surviving female mice exhibit infertility with small ovaries, absent corpus luteum, and ovary cysts, but male mice exhibit normal fertility (18). The skin of the Ntmt1-deficient mice is thin, with an increase in the appearance of skin fibrosis (18).

Putative Mechanism

Ntmt1-deficient mice have reduced body weights and kyphosis (18). The reduced body weight phenotype observed in the puny mice indicates loss of NTMT1 function. The puny mice did not exhibit premature death, indicating that some NTMT1 function is retained.

Primers

PCR Primer
puny_pcr_F: GGCACCCAGTCAGCTTAAATC
puny_pcr_R: AGACATGGTAGATCTCATCTGGC

Sequencing Primer
puny_seq_F: AGTCAGCTTAAATCCCAGCTTCTG
puny_seq_R: GTAGATCTCATCTGGCAGGTTCTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 2, + strand):

1   ggcacccagt cagcttaaat cccagcttct gactctgctt ttgtgtggat aacgtcagaa
61  ctctggcctc ctttggcatg agatggtctt aagatcgaga gagacgcttg ctggcctgtg
121 ctgagggcac acatacggca cgctcacgcc tcgcttctcc ccaggccacc tgacggatca
181 gcacctggct gagtttctgc gccgctgcaa gcggggcctg cgccccaatg gcatcatcgt
241 catcaaggac aacatggccc aggagggtgt gatcctggac gatgtggaca gcagtgtgtg
301 ccgggacctt gaggtggtcc gccggatcat ccgcactgca ggcctcagcc tcctggccga
361 ggagcgccag gagaacctgc cagatgagat ctaccatgtc t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wu, R., Yue, Y., Zheng, X., and Li, H. (2015) Molecular Basis for Histone N-Terminal Methylation by NRMT1. Genes Dev. 29, 2337-2342.

  2. Dong, C., Mao, Y., Tempel, W., Qin, S., Li, L., Loppnau, P., Huang, R., and Min, J. (2015) Structural Basis for Substrate Recognition by the Human N-Terminal Methyltransferase 1. Genes Dev. 29, 2343-2348.

  3. Finak, G., Bertos, N., Pepin, F., Sadekova, S., Souleimanova, M., Zhao, H., Chen, H., Omeroglu, G., Meterissian, S., Omeroglu, A., Hallett, M., and Park, M. (2008) Stromal Gene Expression Predicts Clinical Outcome in Breast Cancer. Nat Med. 14, 518-527.

  4. Lee, S., Chen, J., Zhou, G., Shi, R. Z., Bouffard, G. G., Kocherginsky, M., Ge, X., Sun, M., Jayathilaka, N., Kim, Y. C., Emmanuel, N., Bohlander, S. K., Minden, M., Kline, J., Ozer, O., Larson, R. A., LeBeau, M. M., Green, E. D., Trent, J., Karrison, T., Liu, P. P., Wang, S. M., and Rowley, J. D. (2006) Gene Expression Profiles in Acute Myeloid Leukemia with Common Translocations using SAGE. Proc Natl Acad Sci U S A. 103, 1030-1035.

  5. Nikolsky, Y., Sviridov, E., Yao, J., Dosymbekov, D., Ustyansky, V., Kaznacheev, V., Dezso, Z., Mulvey, L., Macconaill, L. E., Winckler, W., Serebryiskaya, T., Nikolskaya, T., and Polyak, K. (2008) Genome-Wide Functional Synergy between Amplified and Mutated Genes in Human Breast Cancer. Cancer Res. 68, 9532-9540.

  6. Shields, K. M., Tooley, J. G., Petkowski, J. J., Wilkey, D. W., Garbett, N. C., Merchant, M. L., Cheng, A., and Schaner Tooley, C. E. (2017) Select Human Cancer Mutants of NRMT1 Alter its Catalytic Activity and Decrease N-Terminal Trimethylation. Protein Sci. 26, 1639-1652.

  7. Hong, Y., Downey, T., Eu, K. W., Koh, P. K., and Cheah, P. Y. (2010) A 'Metastasis-Prone' Signature for Early-Stage Mismatch-Repair Proficient Sporadic Colorectal Cancer Patients and its Implications for Possible Therapeutics. Clin Exp Metastasis. 27, 83-90.

  8. Sabates-Bellver, J., Van der Flier, L. G., de Palo, M., Cattaneo, E., Maake, C., Rehrauer, H., Laczko, E., Kurowski, M. A., Bujnicki, J. M., Menigatti, M., Luz, J., Ranalli, T. V., Gomes, V., Pastorelli, A., Faggiani, R., Anti, M., Jiricny, J., Clevers, H., and Marra, G. (2007) Transcriptome Profile of Human Colorectal Adenomas. Mol Cancer Res. 5, 1263-1275.

  9. Tooley, C. E., Petkowski, J. J., Muratore-Schroeder, T. L., Balsbaugh, J. L., Shabanowitz, J., Sabat, M., Minor, W., Hunt, D. F., and Macara, I. G. (2010) NRMT is an Alpha-N-Methyltransferase that Methylates RCC1 and Retinoblastoma Protein. Nature. 466, 1125-1128.

  10. Chen, T., Muratore, T. L., Schaner-Tooley, C. E., Shabanowitz, J., Hunt, D. F., and Macara, I. G. (2007) N-Terminal Alpha-Methylation of RCC1 is Necessary for Stable Chromatin Association and Normal Mitosis. Nat Cell Biol. 9, 596-603.

  11. Petkowski, J. J., Schaner Tooley, C. E., Anderson, L. C., Shumilin, I. A., Balsbaugh, J. L., Shabanowitz, J., Hunt, D. F., Minor, W., and Macara, I. G. (2012) Substrate Specificity of Mammalian N-Terminal Alpha-Amino Methyltransferase NRMT. Biochemistry. 51, 5942-5950.

  12. Bailey, A. O., Panchenko, T., Sathyan, K. M., Petkowski, J. J., Pai, P. J., Bai, D. L., Russell, D. H., Macara, I. G., Shabanowitz, J., Hunt, D. F., Black, B. E., and Foltz, D. R. (2013) Posttranslational Modification of CENP-A Influences the Conformation of Centromeric Chromatin. Proc Natl Acad Sci U S A. 110, 11827-11832.

  13. Dai, X., Otake, K., You, C., Cai, Q., Wang, Z., Masumoto, H., and Wang, Y. (2013) Identification of Novel Alpha-n-Methylation of CENP-B that Regulates its Binding to the Centromeric DNA. J Proteome Res. 12, 4167-4175.

  14. Cai, Q., Fu, L., Wang, Z., Gan, N., Dai, X., and Wang, Y. (2014) Alpha-N-Methylation of Damaged DNA-Binding Protein 2 (DDB2) and its Function in Nucleotide Excision Repair. J Biol Chem. 289, 16046-16056.

  15. Dai, X., Rulten, S. L., You, C., Caldecott, K. W., and Wang, Y. (2015) Identification and Functional Characterizations of N-Terminal Alpha-N-Methylation and Phosphorylation of Serine 461 in Human Poly(ADP-Ribose) Polymerase 3. J Proteome Res. 14, 2575-2582.

  16. Villar-Garea, A., Forne, I., Vetter, I., Kremmer, E., Thomae, A., and Imhof, A. (2012) Developmental Regulation of N-Terminal H2B Methylation in Drosophila Melanogaster. Nucleic Acids Res. 40, 1536-1549.

  17. Bonsignore, L. A., Butler, J. S., Klinge, C. M., and Schaner Tooley, C. E. (2015) Loss of the N-Terminal Methyltransferase NRMT1 Increases Sensitivity to DNA Damage and Promotes Mammary Oncogenesis. Oncotarget. 6, 12248-12263.

  18. Bonsignore, L. A., Tooley, J. G., Van Hoose, P. M., Wang, E., Cheng, A., Cole, M. P., and Schaner Tooley, C. E. (2015) NRMT1 Knockout Mice Exhibit Phenotypes Associated with Impaired DNA Repair and Premature Aging. Mech Ageing Dev. 146-148, 42-52.