Phenotypic Mutation 'oscar2'

• Allele: oscar2
• Mutation Type: nonsense
• Chromosome: 3
• Coordinate: 86,571,765 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Lrba
• Gene Name: LPS-responsive beige-like anchor
• Synonym(s): Lba, D3Ertd775e
• Chromosomal Location: 86,131,987-86,689,999 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000103261] [ENSMUSP00000142179] [ENSMUSP00000142043] [ENSMUSP00000141734]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000103261; Gene: ENSMUSG00000028080; AA Change: Y2356*

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	211	377	4.6e-13	PFAM
Pfam:DUF4704	446	717	2.5e-109	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2049	7e-88	PFAM
Pfam:PH_BEACH	2075	2172	9.1e-31	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART
WD40	2760	2798	1.79e-1	SMART
WD40	2801	2840	4.28e0	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000142179; Gene: ENSMUSG00000028080; AA Change: Y2356*

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	7.4e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.5e-92	PFAM
Pfam:PH_BEACH	2068	2172	7.5e-32	PFAM
Beach	2203	2480	2.87e-207	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000142043; Gene: ENSMUSG00000028080; AA Change: Y2356*

Domain	Start	End	E-Value	Type
low complexity region	12	31	N/A	INTRINSIC
Pfam:Laminin_G_3	205	377	8.1e-18	PFAM
coiled coil region	1019	1037	N/A	INTRINSIC
low complexity region	1073	1089	N/A	INTRINSIC
low complexity region	1100	1113	N/A	INTRINSIC
low complexity region	1585	1600	N/A	INTRINSIC
low complexity region	1614	1630	N/A	INTRINSIC
low complexity region	1698	1713	N/A	INTRINSIC
low complexity region	1738	1757	N/A	INTRINSIC
low complexity region	1848	1861	N/A	INTRINSIC
Pfam:DUF1088	1882	2050	1.6e-92	PFAM
Pfam:PH_BEACH	2068	2172	8.3e-32	PFAM
Beach	2203	2480	2.87e-207	SMART
WD40	2578	2615	7.4e0	SMART
WD40	2618	2661	1.72e0	SMART
WD40	2677	2716	3.99e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000141734; Gene: ENSMUSG00000028080; AA Change: Y260*

Domain	Start	End	E-Value	Type
Pfam:PH_BEACH	3	76	3.6e-20	PFAM
Beach	107	384	2.87e-207	SMART
WD40	482	519	7.4e0	SMART
WD40	522	565	1.72e0	SMART
WD40	581	620	3.99e-1	SMART
WD40	664	702	1.79e-1	SMART
WD40	705	744	4.28e0	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-01-23 5:32 PM
• Record Posted: 2019-05-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_030695, NM_001077688, NM_001077687; MGI: 1933162

Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (other)(1) Gene trapped(10) Radiation induced(1) Targeted(1)

Phenotypic Description

Figure 1. Grover mice exhibited susceptibility to DSS-induced colitis at 7 days after DSS exposure. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Grover mice exhibited susceptibility to DSS-induced colitis at 10 days after DSS exposure. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The grover phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4920, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure (1); weight loss is used to measure DSS susceptibility.

Nature of Mutation

Figure 3. Linkage mapping of DSS susceptibility phenotype at day 7 using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 45 mutations (X-axis) identified in the G1 male of pedigree R4920. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 45 mutations. The DSS sensitivity phenotype was linked by continuous variable mapping to two mutations on chromosome 3: Lrba and Fcrl5. The mutation in Lrba was presumed causative as mutations in Lrba are known to cause DSS sensitivity (see oscar). The mutation in Lrba is a T to A transversion at base pair 86,664,458 (v38) on chromosome 3, or base pair 440,555 in the GenBank genomic region NC_000069 encoding Lrba. The strongest association was found with a recessive model of inheritance to the phenotype at day 7, wherein nine variant homozygotes departed phenotypically from 10 homozygous reference mice and 17 heterozygous mice with a P value of 1.416 x 10^-8 (Figure 3).  

The mutation corresponds to residue 7,353 in the mRNA sequence NM_030695 within exon 47 of 57 total exons.

7336 TTGATTCCTGAATTTTATTATCTCCCTGAGATG 2351 -L--I--P--E--F--Y--Y--L--P--E--M-

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 2,356 for a premature stop codon (Y2356*) in the LRBA protein.

Protein Prediction

Figure 4. Domain organization of LRBA. The location of the oscar2 mutation is indicated. Domain information is from SMART and UniProt. This image is interactive; click to view additional mutations in Lrba

Lrba encodes lipopolysaccharide-responsive beige-like anchor protein (LRBA), a member of the WDL-BEACH [beige and Chediak-Higashi syndrome]-WD (WBW) gene family. LRBA has similar features of both beige/Chediak-Higashi syndrome-1 (see the record for souris) and A-kinase anchor proteins (AKAPs). LRBA has a ConA-like domain, a VHS (VPS [vacuolar protein sorting]-27, Hrs [hepatocyte growth factor-regulated tyrosine kinase substrate], STAM [signal transducing adaptor molecule]) domain, a WD (tryptophan/aspartic acid) repeat-like (WDL) domain, a DUF1088 (domain of unknown function 1088)  domain, a pleckstrin homology (PH) domain, a BEACH domain with an SH3-binding site, and five WD40 domains (Figure 4) (2-4).

The oscar2 mutation results in substitution of tyrosine 2,356 for a premature stop codon (Y2356*) in the LRBA protein; amino acid 2,356 is within the BEACH domain.

Please see the record oscar for more information about Lrba.

Putative Mechanism

LRBA functions in the regulation of endosomal trafficking by mediating the endocytosis of ligand-activated receptors and immune effector molecules including CTLA-4 (5) and epidermal growth factor receptor (EGFR; see the record for Velvet) (6).

Mutations in LRBA are linked to common variable immunodeficiency 8 with autoimmunity (CVID8; OMIM: #614700) (5;7-10). Patients with CVID8 have early-childhood onset of recurrent infections and also developed variable autoimmune disorders, including idiopathic thrombocytopenia purpura, autoimmune hemolytic anemia, and inflammatory bowel disease [(7); reviewed in (10;11)]. The CVID8 patients had hypogammaglobulinemia, reduced numbers of switched memory B cells, and redcued numbers of CD4+ regulatory T cells (7;8). B cells from the patients showed a failure to proliferate, differentiate, or produce antibodies as well as an increased susceptibility to apoptosis (7). An LRBA mutation (p.I2824P) that resulted in normal expression of the mutant protein was linked to early IBD-like symptoms; the patient did not exhibit overt immunodeficiency (12).

Increased signaling from one or more of the endosomal TLRs (TLR3, TLR7, and TLR9) results in increased production of inflammatory cytokines and increased susceptibility to DSS-induced colitis in the Lrba^-/-  mice (1). DSS-treated Lrba^-/- mice showed increased infiltration of inflammatory cells in the colon as well as impaired epithelial cell architecture in the colon. The DSS-treated Lrba^-/  colon showed increased expression levels of pro-inflammatory cytokines, including TNF, IL-6, IL-1-b, IFN-a, IFN-b, and IFN-g. Experiments showed that T and B cells were not necessary for the development of DSS-induced colitis in the Lrba^-/- mice. LRBA function in innate immune cells, namely macrophages and dendritic cells, was required for recovery and restoration of intestinal homeostasis after DSS treatment. Excessive type I interferon in the Lrba^-/- mice did not contribute to DSS susceptibility. However, PI3K/AKT/mTOR signaling was increased in the Lrba^-/- dendritic cells, resulting in hyperactivation of IRF3 and IRF7 in response to endosomal TLR stimulation and subsequent increased production of type I IFN, IFN-stimulated genes, and IRF-dependent cytokines.

Primers

PCR Primer
oscar2_pcr_F: AGATGCTGGGTACATTTTCCTC
oscar2_pcr_R: CCTATCAGCTAAGCACTGTACAG

Sequencing Primer
oscar2_seq_F: GCTGGGTACATTTTCCTCTAAACAG
oscar2_seq_R: GGCAGGGGTTAATGTTTTACATCAAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 411 nucleotides is amplified (chromosome 3, + strand):

1   agatgctggg tacattttcc tctaaacaga aagttgttga acaaagagaa aatattccct
61  acatattttt gttgttgtgc ttctgtgtaa taggaaataa tcagaatgtg ttacttatat
121 ctagtctata tcctatattt tatgatataa cacttctctc atttttatat aggaattgat
181 tcctgaattt tattatctcc ctgagatgtt tgtcaacttc aataattata accttggagt
241 gatggatgat gggacagtgg tgtctgatgt tgaacttcct ccttgggcca aaacctcgga
301 agaattcgtt cgcataaaca gactggtaag atagtcatca cctgctctgt catgtgttga
361 tgtaaaacat taacccctgc ctttctttct gtacagtgct tagctgatag g

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wang, K., Zhan, W., McAlpine, W., Zhang, Z., Choi, J. H., Shi, H., Misawa, T., Yue, T., Zhang, D., Wang, Y., Ludwig, S., Russell, J., Tang, M., Li, X., Murray, A. R., Moresco, E. M. Y., Turer, E. E., and Beutler, B. (2019) Enhanced Susceptibility to Chemically Induced Colitis Caused by Excessive Endosomal TLR Signaling in LRBA-Deficient Mice. Proc Natl Acad Sci ,USA. May 2019, 201901407; DOI: 10.1073/pnas.1901407116. Accessed May 16, 2019.

  2. Wang, J. W., Howson, J., Haller, E., and Kerr, W. G. (2001) Identification of a Novel Lipopolysaccharide-Inducible Gene with Key Features of both A Kinase Anchor Proteins and chs1/beige Proteins. J Immunol. 166, 4586-4595.

  3. Gebauer, D., Li, J., Jogl, G., Shen, Y., Myszka, D. G., and Tong, L. (2004) Crystal Structure of the PH-BEACH Domains of Human LRBA/BGL. Biochemistry. 43, 14873-14880.

  4. Martinez Jaramillo, C., and Trujillo-Vargas, C. M. (2018) LRBA in the Endomembrane System. Colomb Med (Cali). 49, 236-243.

  5. Alangari, A., Alsultan, A., Adly, N., Massaad, M. J., Kiani, I. S., Aljebreen, A., Raddaoui, E., Almomen, A. K., Al-Muhsen, S., Geha, R. S., and Alkuraya, F. S. (2012) LPS-Responsive Beige-Like Anchor (LRBA) Gene Mutation in a Family with Inflammatory Bowel Disease and Combined Immunodeficiency. J Allergy Clin Immunol. 130, 481-8.e2.

  6. Wang, J. W., Gamsby, J. J., Highfill, S. L., Mora, L. B., Bloom, G. C., Yeatman, T. J., Pan, T. C., Ramne, A. L., Chodosh, L. A., Cress, W. D., Chen, J., and Kerr, W. G. (2004) Deregulated Expression of LRBA Facilitates Cancer Cell Growth. Oncogene. 23, 4089-4097.

  7. Lopez-Herrera, G., Tampella, G., Pan-Hammarstrom, Q., Herholz, P., Trujillo-Vargas, C. M., Phadwal, K., Simon, A. K., Moutschen, M., Etzioni, A., Mory, A., Srugo, I., Melamed, D., Hultenby, K., Liu, C., Baronio, M., Vitali, M., Philippet, P., Dideberg, V., Aghamohammadi, A., Rezaei, N., Enright, V., Du, L., Salzer, U., Eibel, H., Pfeifer, D., Veelken, H., Stauss, H., Lougaris, V., Plebani, A., Gertz, E. M., Schaffer, A. A., Hammarstrom, L., and Grimbacher, B. (2012) Deleterious Mutations in LRBA are Associated with a Syndrome of Immune Deficiency and Autoimmunity. Am J Hum Genet. 90, 986-1001.

  8. Charbonnier, L. M., Janssen, E., Chou, J., Ohsumi, T. K., Keles, S., Hsu, J. T., Massaad, M. J., Garcia-Lloret, M., Hanna-Wakim, R., Dbaibo, G., Alangari, A. A., Alsultan, A., Al-Zahrani, D., Geha, R. S., and Chatila, T. A. (2015) Regulatory T-Cell Deficiency and Immune Dysregulation, Polyendocrinopathy, Enteropathy, X-Linked-Like Disorder Caused by Loss-of-Function Mutations in LRBA. J Allergy Clin Immunol. 135, 217-227.

  9. Lo, B., Zhang, K., Lu, W., Zheng, L., Zhang, Q., Kanellopoulou, C., Zhang, Y., Liu, Z., Fritz, J. M., Marsh, R., Husami, A., Kissell, D., Nortman, S., Chaturvedi, V., Haines, H., Young, L. R., Mo, J., Filipovich, A. H., Bleesing, J. J., Mustillo, P., Stephens, M., Rueda, C. M., Chougnet, C. A., Hoebe, K., McElwee, J., Hughes, J. D., Karakoc-Aydiner, E., Matthews, H. F., Price, S., Su, H. C., Rao, V. K., Lenardo, M. J., and Jordan, M. B. (2015) AUTOIMMUNE DISEASE. Patients with LRBA Deficiency show CTLA4 Loss and Immune Dysregulation Responsive to Abatacept Therapy. Science. 349, 436-440.

  10. Habibi, S., Zaki-Dizaji, M., Rafiemanesh, H., Lo, B., Jamee, M., Gamez-Diaz, L., Salami, F., Kamali, A. N., Mohammadi, H., Abolhassani, H., Yazdani, R., Aghamohammadi, A., Anaya, J. M., and Azizi, G. (2019) Clinical, Immunologic, and Molecular Spectrum of Patients with LPS-Responsive Beige-Like Anchor Protein (LRBA) Deficiency: A Systematic Review. J Allergy Clin Immunol Pract. .

  11. Alkhairy, O. K., Abolhassani, H., Rezaei, N., Fang, M., Andersen, K. K., Chavoshzadeh, Z., Mohammadzadeh, I., El-Rajab, M. A., Massaad, M., Chou, J., Aghamohammadi, A., Geha, R. S., and Hammarstrom, L. (2016) Spectrum of Phenotypes Associated with Mutations in LRBA. J Clin Immunol. 36, 33-45.

  12. Serwas, N. K., Kansu, A., Santos-Valente, E., Kuloglu, Z., Demir, A., Yaman, A., Gamez Diaz, L. Y., Artan, R., Sayar, E., Ensari, A., Grimbacher, B., and Boztug, K. (2015) Atypical Manifestation of LRBA Deficiency with Predominant IBD-Like Phenotype. Inflamm Bowel Dis. 21, 40-47.