Phenotypic Mutation 'banned' (pdf version)
Allelebanned
Mutation Type critical splice acceptor site
Chromosome19
Coordinate55,931,432 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Tcf7l2
Gene Name transcription factor 7 like 2, T cell specific, HMG box
Synonym(s) TCF4B, mTcf-4B, mTcf-4E, TCF4E, Tcf4, Tcf-4
Chromosomal Location 55,741,810-55,933,654 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001142918 (variant 1), NM_001142919 (variant 2), NM_009333 (variant 3) NM_001142920 (variant 4), NM_001142921 (variant 5), NM_001142922 (variant 6), NM_001142923 (variant 7), NM_001142924 (variant 8)…see NCBI for additional transcript variants; MGI:1202879

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000042950] [ENSMUSP00000050081] [ENSMUSP00000107273] [ENSMUSP00000107283] [ENSMUSP00000107284] [ENSMUSP00000107286] [ENSMUSP00000107287] [ENSMUSP00000107291] [ENSMUSP00000118661]
SMART Domains Protein: ENSMUSP00000042950
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000050081
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000107273
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 2.4e-37 PFAM
HMG 166 236 1.16e-22 SMART
low complexity region 242 250 N/A INTRINSIC
c-clamp 278 298 2.25e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000107283
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 458 2.25e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000107284
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 468 2.08e-14 SMART
low complexity region 471 498 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000107286
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.5e-93 PFAM
HMG 350 420 1.16e-22 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000107287
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-96 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000107291
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-103 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 421 442 1.23e-2 SMART
c-clamp 446 476 1.35e-13 SMART
low complexity region 479 506 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000123428
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 229 9.3e-98 PFAM
HMG 319 389 1.16e-22 SMART
low complexity region 395 403 N/A INTRINSIC
c-clamp 414 434 2.25e-1 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000118661
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 217 1.2e-64 PFAM
HMG 307 377 1.16e-22 SMART
low complexity region 383 391 N/A INTRINSIC
c-clamp 402 432 5.29e-7 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10
DSS: sensitive day 7
FACS CD44+ CD8 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(34) : Endonuclease-mediated(3) Gene trapped(15) Targeted(12) Transgenic(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Tcf7l2 APN 19 55917421 missense probably damaging 1.00
IGL01013:Tcf7l2 APN 19 55919627 splice site probably benign
IGL02871:Tcf7l2 APN 19 55918997 missense probably damaging 1.00
R0927:Tcf7l2 UTSW 19 55918955 missense probably damaging 1.00
R1078:Tcf7l2 UTSW 19 55743195 missense probably benign 0.19
R4580:Tcf7l2 UTSW 19 55919036 missense probably damaging 1.00
R4721:Tcf7l2 UTSW 19 55931454 missense possibly damaging 0.89
R4814:Tcf7l2 UTSW 19 55924072 nonsense probably null
R4957:Tcf7l2 UTSW 19 55931432 critical splice acceptor site probably null
R5222:Tcf7l2 UTSW 19 55898612 missense probably benign
R5484:Tcf7l2 UTSW 19 55919508 splice site probably null
R5808:Tcf7l2 UTSW 19 55908541 missense probably damaging 1.00
R5914:Tcf7l2 UTSW 19 55898560 missense probably benign 0.00
R6077:Tcf7l2 UTSW 19 55917436 nonsense probably null
R6116:Tcf7l2 UTSW 19 55919014 missense probably damaging 1.00
R6861:Tcf7l2 UTSW 19 55742523 missense probably damaging 1.00
R6970:Tcf7l2 UTSW 19 55755048 missense probably benign 0.44
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-10-25 10:30 AM by Anne Murray
Record Created 2017-02-02 10:27 PM
Record Posted 2018-10-25
Phenotypic Description

Figure 1. Banned mice exhibited weight loss at day 7 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Banned mice exhibited weight loss at day 10 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The banned phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4957, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure; weight loss is used to measure DSS susceptibility.

Nature of Mutation

Figure 3. Linkage mapping of the DSS-induced phenotype at day 10 using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 75 mutations (X-axis) identified in the G1 male of pedigree R4957. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 75 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Tcf7l2: an A to G transition at base pair 55,931,432 (v38) on chromosome 19, or base pair 189,648 in the GenBank genomic region NC_000085 within the acceptor splice site of intron 14. The strongest association was found with a recessive model of linkage to the normalized DSS phenotype at day 10, wherein two variant homozygotes departed phenotypically from five homozygous reference mice and nine heterozygous mice with a P value of 8.976 x 10-6 (Figure 3).  

 

The effects of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in use of a cryptic site in intron 13. Use of the cryptic splice site would result in a transcript with a 24-base pair insertion of intron 13. The insertion would cause a frame-shifted protein product beginning after amino acid 422 of the protein, and subsequent termination after the inclusion of 148 aberrant amino acids.

 

           <--exon 13         <--exon 14-->                 <--intron 14 exon 15-->
184254 ……CGGCCCCTGCAG ATGCAAATA……CGGGCTTGA……AAACCCTGCAG ……ccccctgtttctag AGAAAAAAAAAGTG……
419 ……-G--P--C--R- -C--K--Y-……-R--A--*

                  correct

 

Genomic numbering corresponds to NC_000085. The acceptor splice site of intron 14, which is destroyed by the banned mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 4. Domain organization of TCF7L2. The banned mutation destroys the acceptor splice site of intron 14. Abbreviations: HMG, high-mobility group; NLS, nuclear localization sequence; CtBP, C-terminal-binding protein-binding site.
Figure 5. Crystal structure of human TCF7L2 with β-catenin. β-catenin is shown in cyan, and TCF7L2 is shown in pink. UCSF Chimera model is based on PDB 1JPW, Poy, et al. Nat.Struct.Mol.Biol. 8, 1053-1057 (2001). Click on the 3D structure to view it rotate.

TCF7L2 (alternatively, T-cell transcription factor-4 [TCF4]) is a member of the T-cell factor/lymphoid enhancer factor (TCF/LEF) transcription factor family. All of the TCF/LEF proteins share a β-catenin-binding domain, a Groucho (alternatively transducin-like enhancer of split [TLE]) binding sequence, and a high-mobility group (HMG) box that mediates DNA binding (Figure 4). TCF7L2 also has an evolutionarily conserved C-terminal CRARF-type domain putatively involved in TCF7L2 promoter activation, and a CtBP (C-terminal-binding protein)-binding site (1;2)

 

The crystal structure of the human TCF7L2/β-catenin complex has been solved [Figure 5; PDB:1JPW (3)]. The central armadillo repeat-containing region of β-catenin interacts with two sites on TCF7L2. The first site of interaction is an extended region (amino acids 13 to 25), which interacts with β-catenin armadillo repeats 4 through 9. A C-terminal helix of TCF7L2 (amino acids 40 to 50) interacts with armadillo repeats 3 through 5.

 

The mouse and human TCF7L2 genes produce several splice variants. Exons 4, 12, 13, 14, 15, and 16 can be alternatively spliced, leading to the generation of 13 different transcripts (1;4;5). Alternative splicing of exons 12, 13, 13a, and 13b can lead to stop codons in exons 13a, 13b, or 14 resulting in proteins with short, medium, or long reading frames (6). Two splice variants lack the β-catenin-binding domain, and another splice variant lacks the CtBP-binding site.

 

The banned mutation is predicted to cause a frame-shifted protein product beginning after amino acid 433 of the TCF7L2 protein (isoform 3), and subsequent termination after the inclusion of 34 aberrant amino acids. The mutation would putatively affect the CtBP-binding site.

Expression/Localization

TCF7L2 is ubiquitously expressed, with highest expression in the pancreas, colon, brain, small intestine, monocytes, and lung (2). TCF7L2 is expressed at lower levels in all other tissues examined (2). Little to no expression was detected in activated or resting T and B cells (2).

 

The TCF7L2 splice variants exhibit variable tissue-specific expression. The splice variant lacking the CtBP-binding site is specifically expressed in pancreatic islets, pancreas, and colon (2).

Background
Figure 6. Wnt Signaling Pathways. Wnt glycoproteins are palmitolated by porcupine family proteins (Porcn) and secreted into the extracellular matrix with the assistance of the retromer complex. In the extracelluar matrix, heparan sulfate proteoglycans bind to Wnt proteins, stabilizing them for binding to the seven transmembrane Frizzled receptor and coreceptor LRP5 or LRP6. Several Wnt inhibitors, including Dickkopf (Dkk), Wnt-inhibitor protein (WIF), soluble Frizzled-related proteins (SFRP), Cerberus, Frzb, and Wise, bind Wnts or their receptors directly and prevent Wnt from interacting with LRP5/6 and Frizzled. Canonical Wnt/β-catenin pathway: In the absence of Wnt, β-catenin is constantly degraded. β-catenin is phosphorylated by glycogen synthase kinase 3 (GSK3) and casein kinase 1α (CK1α) in a destruction complex that also contains adenomatous polyposis coli (APC) and Axin. Phosphorylation allows association with β-TrCP, an E3 ubiquitin ligase subunit that targets β-catenin for proteasome-mediated degradation. Thus, β-catenin cannot travel to the nucleus and Wnt target genes are repressed by lymphoid enhancer-binding factor 1/T cell-specific transcription factor (LEF/TCF) proteins. Wnt binding to Frizzled and LRP5/6 results in recruitment of Dishevelled (Dsh) and Axin, and LRP5/6 phosphorylation by GSK3 and CK1γ. Dsh is also phosphorylated by casein kinase 1/2 (CK1/2), metastasis associated kinase (MAK), protein kinase C (PKC), and Par1. These events disrupt the β-catenin destruction complex, thereby permitting the stabilization of β-catenin, which accumulates in the cell and translocates into the nucleus where it associates with and coactivates LEF/TCF to stimulate target gene expression. The two non-canonical Wnt signaling pathways control cell polarization and migration and do not require LRP5/6 nor act through β-catenin. In the Planar Cell Polarity Pathway, Wnt-activated signals arising from Frizzled recruit Dsh to the cell membrane. Dsh activates cytoskeletal regulatory pathways, either directly (for Rac) or through Dishevelled associated activator of morphogenesis 1 (Daam1) (for Rho and profilin). In addition to cytoskeletal regulation, Rac also controls transcription through activation of JNK. In the Wnt/Ca2+ Pathway, binding of Wnt to Frizzled recruits G-proteins that activate Dsh. Several molecules subsequently control Ca2+ release from the endoplasmic reticulum, including Protein Kinase G (PKG) that inhibits Ca2+ release, and phospholipase C (PLC) that stimulates Ca2+ release through the generation of IP3. Diacylglycerol (DAG), also generated by PLC, together with Ca2+, activates protein kinase C (PKC), leading to control of tissue separation through Cdc42. Ventral fate is regulated by the Wnt/Ca2+ pathway through the action of calcineurin and nuclear factor of activated T cells (NFAT). The Wnt/Ca2+ pathway also inhibits the canonical Wnt pathway through calcium/calmodulin-dependent protein kinase II (CamKII), TAK1, and NEMO. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Wnt proteins regulate many stages of development, from patterning of the embryo and generation of tissues and cell types, to regulation of cell movements, polarity, axon guidance and synapse formation (7-9). Defective Wnt signaling plays major roles in diseases such as cancer and osteoporosis (7). The first step in Wnt signaling is binding of ligand to receptor (Figure 6). Wnt receptors include members of the Frizzled (Fzd) family of seven-pass transmembrane receptors (8), as well as LRP5/LRP6/Arrow (10), which function as co-receptors for Frizzled proteins.  Multiple studies suggest that Wnt ligands bind to both Frizzled and LRP5 (see the record for r18)/6 receptors and induce a complex formation between Frizzled proteins and LRP5/6 (11;12).  Unlike Frizzled receptors, LRP5/6 specifically functions in canonical Wnt signaling.  Canonical Wnt signaling relies on the regulation of the stability/abundance of the β-catenin protein that acts as a nuclear co-activator for the TCF/LEF (T-cell factor/Lymphoid enhancer factor) family of transcription factors (13;14).  In the absence of Wnt signal, cytosolic β-catenin levels are low due to phosphorylation-dependent ubiquitination and subsequent degradation.  β-catenin phosphorylation involves the sequential actions of casein kinase 1 (CK1) and glycogen synthase kinase 3 (GSK3), and takes place in a protein complex assembled by Axin and APC (15).  Phosphorylated β-catenin is then recognized and ubiquitinated by a ubiquitin-ligase complex. Inhibition of β-catenin phosphorylation can occur through several mechanisms; degradation of the Axin protein, alteration of the Axin complex, or inhibition of CK1 or GSK3 activity (10). In the absence of β-catenin, TCF/LEF suppresses Wnt-responsive gene expression by recruiting nuclear corepressors. Upon Wnt stimulation, β-catenin phosphorylation and degradation is inhibited, and β-catenin protein is available to associate with TCF/LEF to activate target gene expression. TCF7L2 is one of several TCF family members (i.e., TCF7L2, TCF7, TCF7L1, and LEF-1) that can interact with β-catenin (1).

 

TCF7L2 functions in glucose homeostasis by repressing the proglucagon gene in enteroendocrine cells (16;17). In addition, the TCF7L2/β-catenin pathway can activate the transcription of the PKD1 gene. TCF7L2 also regulates proinsulin synthesis as well as processing (and possibly clearance) of proinsulin and insulin (18). Mutations in TCF7L2 are associated with susceptibility to type 2 diabetes mellitus (OMIM: #125853) (19-22). The risk T-allele rs7903146 is associated with impaired glucose-stimulated insulin secretion, and patients with this allele show elevated plasma proinsulin level and an increased proinsulin-to-insulin ratios (23-25).

 

TCF7L2 regulates adipocyte development and function (26). TCF7L2 silencing blocks adipogenesis by disrupting Wnt signaling (26). TCF7L2 inactivation through deletion of the HMG box results in whole-body glucose intolerance, hepatic insulin resistance, increased subcutaneous adipose tissue mass, adipocyte hypertrophy, and inflammation (26).

 

TCF7L2 promotes oligodendrocyte differentiation during myelin formation and remyelination by an unknown mechanism (27). Mice with conditional knockout of TCF7L2 in oligodendroglial lineage cells showed shorter riding times on the rotarod during a rotarod performance test compared to control mice (27). The conditional knockout mice showed lack of remyelination in the corpus callosum after treatment with cuprizone, while control mice showed almost complete remyelination.

 

Tcf7l2-deficient mice are neonatal lethal at birth (28-31). Tcf7l2-deficient embryos exhibited increased numbers of proliferating cells in the intestine (at embryonic day 13.5), but the number of proliferating cells in the colon was decreased compared to wild-type mice (29). Tcf7l2-deficient embryos also had increased combined volumes of the anterior and intermediate pituitary gland lobes (32). Tcf7l2-deficient mice exhibit fragile intestines, increased necrosis of epithelial cells of the small intestine and colon, reduced birth weights, hypoglycemia, and lack of crypt structures due to necrosis (29;30). Heterozygous mice (Tcf7l2+/-) exhibited reduced body weights, increased circulating glucose levels, reduced circulating insulin levels, and impaired glucose tolerance (31;33). Tcf7l2+/- mice also showed anxiety-like phenotypes in open field and light dark box tests with concomitant reduced distances traveled in the open field (34). The mice also showed enhanced fear learning. Pancreas-specific Tcf7l2-null mice showed impaired glucose tolerance and impaired insulin secretion (35).

Putative Mechanism

TCF7L2 is expressed along the crypt-villus axis in the small intestine and at high levels in the noncycling cells in the upper colonic crypt (29;36). β-catenin/TCF7L2 controls proliferation versus differentiation in healthy and malignant intestinal epithelial cells through the EphB2/EphB3 (see the record for turtle) and ephrin B1 pathways (37;38). Disruption of β-catenin/TCF7L2 activity in colorectal cancer cells causes G1 arrest and blockade of a genetic program that was physiologically active in the proliferative compartment of colon crypts (37). In some patients with colorectal cancer that have inactivation of the APC gene, beta-catenin accumulates and associates with TCF7L2 to activate TCF7L2-regulated genes (39;40). Mutations in TCF7L2 have been observed in colorectal cancer cell lines (41;42). A VTI1A/TCF7L2 fusion gene has been observed in colorectal cancers (43).

 

Mice with conditional knockout of TCF7L2 in adult intestine showed total absence of proliferative cells in the small intestinal crypt and the colon (44). TCF7L2 is required for the maintenance of the Lgr5+ stem cells in the adult small intestine (44). The phenotype observed in the banned mice indicates loss of TCF7L2-associated function.

Primers PCR Primer
banned(F):5'- GGCAAATCAGAGTGGACCTG -3'
banned(R):5'- TTGGTCACCAGAGACAGAGG -3'

Sequencing Primer
banned_seq(F):5'- TCAGAGTGGACCTGGGAGC -3'
banned_seq(R):5'- TTCCAGCCAGCGAGTTGTG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler