Phenotypic Mutation 'banned'

• Allele: banned
• Mutation Type: critical splice acceptor site
• Chromosome: 19
• Coordinate: 55,919,864 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Tcf7l2
• Gene Name: transcription factor 7 like 2, T cell specific, HMG box
• Synonym(s): Tcf4, TCF4E, Tcf-4, mTcf-4B, mTcf-4E, TCF4B
• Chromosomal Location: 55,730,252-55,922,086 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010] ; PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000042950 ^†] [ENSMUSP00000050081 ^†] [ENSMUSP00000107273 ^†] [ENSMUSP00000107283 ^†] [ENSMUSP00000107284 ^†] [ENSMUSP00000107286 ^†] [ENSMUSP00000107287 ^†] [ENSMUSP00000107291 ^†] [ENSMUSP00000118661 ^†] † probably from a misspliced transcript
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000042950; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	236	1.5e-95	PFAM
HMG	326	396	1.16e-22	SMART
low complexity region	402	410	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000050081; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	236	1.7e-95	PFAM
HMG	326	396	1.16e-22	SMART
low complexity region	402	410	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000107273; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	76	2.4e-37	PFAM
HMG	166	236	1.16e-22	SMART
low complexity region	242	250	N/A	INTRINSIC
c-clamp	278	298	2.25e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000107283; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	236	1.5e-95	PFAM
HMG	326	396	1.16e-22	SMART
low complexity region	402	410	N/A	INTRINSIC
c-clamp	438	458	2.25e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000107284; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	236	2.1e-95	PFAM
HMG	326	396	1.16e-22	SMART
low complexity region	402	410	N/A	INTRINSIC
c-clamp	438	468	2.08e-14	SMART
low complexity region	471	498	N/A	INTRINSIC
low complexity region	519	539	N/A	INTRINSIC
low complexity region	564	578	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000107286; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	259	4.5e-93	PFAM
HMG	350	420	1.16e-22	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000107287; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	236	1.7e-96	PFAM
HMG	331	401	1.16e-22	SMART
low complexity region	407	415	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000107291; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	236	1.7e-103	PFAM
HMG	326	396	1.16e-22	SMART
low complexity region	402	410	N/A	INTRINSIC
c-clamp	421	442	1.23e-2	SMART
c-clamp	446	476	1.35e-13	SMART
low complexity region	479	506	N/A	INTRINSIC
low complexity region	527	547	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123428; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	229	9.3e-98	PFAM
HMG	319	389	1.16e-22	SMART
low complexity region	395	403	N/A	INTRINSIC
c-clamp	414	434	2.25e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123428; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	229	9.3e-98	PFAM
HMG	319	389	1.16e-22	SMART
low complexity region	395	403	N/A	INTRINSIC
c-clamp	414	434	2.25e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123428; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	229	9.3e-98	PFAM
HMG	319	389	1.16e-22	SMART
low complexity region	395	403	N/A	INTRINSIC
c-clamp	414	434	2.25e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123428; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	229	9.3e-98	PFAM
HMG	319	389	1.16e-22	SMART
low complexity region	395	403	N/A	INTRINSIC
c-clamp	414	434	2.25e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000118661; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	217	1.2e-64	PFAM
HMG	307	377	1.16e-22	SMART
low complexity region	383	391	N/A	INTRINSIC
c-clamp	402	432	5.29e-7	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000118661; Gene: ENSMUSG00000024985

Domain	Start	End	E-Value	Type
Pfam:CTNNB1_binding	1	217	1.2e-64	PFAM
HMG	307	377	1.16e-22	SMART
low complexity region	383	391	N/A	INTRINSIC
c-clamp	402	432	5.29e-7	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9490
• Is this an essential gene?: Essential (E-score: 1.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-02-02 10:27 PM
• Record Posted: 2018-10-25
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001142918 (variant 1), NM_001142919 (variant 2), NM_009333 (variant 3) NM_001142920 (variant 4), NM_001142921 (variant 5), NM_001142922 (variant 6), NM_001142923 (variant 7), NM_001142924 (variant 8)…see NCBI for additional transcript variants; MGI:1202879

Alleles Listed at MGI

All Mutations and Alleles(34) : Endonuclease-mediated(3) Gene trapped(15) Targeted(12) Transgenic(4)

Phenotypic Description

Figure 1. Banned mice exhibited weight loss at day 7 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Banned mice exhibited weight loss at day 10 after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The banned phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4957, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure; weight loss is used to measure DSS susceptibility.

Nature of Mutation

Figure 3. Linkage mapping of the DSS-induced phenotype at day 10 using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 75 mutations (X-axis) identified in the G1 male of pedigree R4957. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 75 mutations. The DSS susceptibility phenotype was linked by continuous variable mapping to a mutation in Tcf7l2: an A to G transition at base pair 55,931,432 (v38) on chromosome 19, or base pair 189,648 in the GenBank genomic region NC_000085 within the acceptor splice site of intron 14. The strongest association was found with a recessive model of linkage to the normalized DSS phenotype at day 10, wherein two variant homozygotes departed phenotypically from five homozygous reference mice and nine heterozygous mice with a P value of 8.976 x 10^-6 (Figure 3).  

The effects of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in use of a cryptic site in intron 13. Use of the cryptic splice site would result in a transcript with a 24-base pair insertion of intron 13. The insertion would cause a frame-shifted protein product beginning after amino acid 422 of the protein, and subsequent termination after the inclusion of 148 aberrant amino acids.

<--exon 13 <--exon 14--> <--intron 14 exon 15--> 184254 ……CGGCCCCTGCAG ATGCAAATA……CGGGCTTGA……AAACCCTGCAG ……ccccctgtttctag AGAAAAAAAAAGTG…… 419 ……-G--P--C--R- -C--K--Y-……-R--A--*                   correct

Genomic numbering corresponds to NC_000085. The acceptor splice site of intron 14, which is destroyed by the banned mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 4. Domain organization of TCF7L2. The banned mutation destroys the acceptor splice site of intron 14. Abbreviations: HMG, high-mobility group; NLS, nuclear localization sequence; CtBP, C-terminal-binding protein-binding site.

Figure 5. Crystal structure of human TCF7L2 with β-catenin. β-catenin is shown in cyan, and TCF7L2 is shown in pink. UCSF Chimera model is based on PDB 1JPW, Poy, et al. Nat.Struct.Mol.Biol. 8, 1053-1057 (2001). Click on the 3D structure to view it rotate.

TCF7L2 (alternatively, T-cell transcription factor-4 [TCF4]) is a member of the T-cell factor/lymphoid enhancer factor (TCF/LEF) transcription factor family. All of the TCF/LEF proteins share a β-catenin-binding domain, a Groucho (alternatively transducin-like enhancer of split [TLE]) binding sequence, and a high-mobility group (HMG) box that mediates DNA binding (Figure 4). TCF7L2 also has an evolutionarily conserved C-terminal CRARF-type domain putatively involved in TCF7L2 promoter activation, and a CtBP (C-terminal-binding protein)-binding site (1;2). 

The crystal structure of the human TCF7L2/β-catenin complex has been solved [Figure 5; PDB:1JPW (3)]. The central armadillo repeat-containing region of β-catenin interacts with two sites on TCF7L2. The first site of interaction is an extended region (amino acids 13 to 25), which interacts with β-catenin armadillo repeats 4 through 9. A C-terminal helix of TCF7L2 (amino acids 40 to 50) interacts with armadillo repeats 3 through 5.

The mouse and human TCF7L2 genes produce several splice variants. Exons 4, 12, 13, 14, 15, and 16 can be alternatively spliced, leading to the generation of 13 different transcripts (1;4;5). Alternative splicing of exons 12, 13, 13a, and 13b can lead to stop codons in exons 13a, 13b, or 14 resulting in proteins with short, medium, or long reading frames (6). Two splice variants lack the β-catenin-binding domain, and another splice variant lacks the CtBP-binding site.

The banned mutation is predicted to cause a frame-shifted protein product beginning after amino acid 433 of the TCF7L2 protein (isoform 3), and subsequent termination after the inclusion of 34 aberrant amino acids. The mutation would putatively affect the CtBP-binding site.

Expression/Localization

TCF7L2 is ubiquitously expressed, with highest expression in the pancreas, colon, brain, small intestine, monocytes, and lung (2). TCF7L2 is expressed at lower levels in all other tissues examined (2). Little to no expression was detected in activated or resting T and B cells (2).

The TCF7L2 splice variants exhibit variable tissue-specific expression. The splice variant lacking the CtBP-binding site is specifically expressed in pancreatic islets, pancreas, and colon (2).

Background

Figure 6. Wnt Signaling Pathways. Wnt glycoproteins are palmitolated by porcupine family proteins (Porcn) and secreted into the extracellular matrix with the assistance of the retromer complex. In the extracelluar matrix, heparan sulfate proteoglycans bind to Wnt proteins, stabilizing them for binding to the seven transmembrane Frizzled receptor and coreceptor LRP5 or LRP6. Several Wnt inhibitors, including Dickkopf (Dkk), Wnt-inhibitor protein (WIF), soluble Frizzled-related proteins (SFRP), Cerberus, Frzb, and Wise, bind Wnts or their receptors directly and prevent Wnt from interacting with LRP5/6 and Frizzled. Canonical Wnt/β-catenin pathway: In the absence of Wnt, β-catenin is constantly degraded. β-catenin is phosphorylated by glycogen synthase kinase 3 (GSK3) and casein kinase 1α (CK1α) in a destruction complex that also contains adenomatous polyposis coli (APC) and Axin. Phosphorylation allows association with β-TrCP, an E3 ubiquitin ligase subunit that targets β-catenin for proteasome-mediated degradation. Thus, β-catenin cannot travel to the nucleus and Wnt target genes are repressed by lymphoid enhancer-binding factor 1/T cell-specific transcription factor (LEF/TCF) proteins. Wnt binding to Frizzled and LRP5/6 results in recruitment of Dishevelled (Dsh) and Axin, and LRP5/6 phosphorylation by GSK3 and CK1γ. Dsh is also phosphorylated by casein kinase 1/2 (CK1/2), metastasis associated kinase (MAK), protein kinase C (PKC), and Par1. These events disrupt the β-catenin destruction complex, thereby permitting the stabilization of β-catenin, which accumulates in the cell and translocates into the nucleus where it associates with and coactivates LEF/TCF to stimulate target gene expression. The two non-canonical Wnt signaling pathways control cell polarization and migration and do not require LRP5/6 nor act through β-catenin. In the Planar Cell Polarity Pathway, Wnt-activated signals arising from Frizzled recruit Dsh to the cell membrane. Dsh activates cytoskeletal regulatory pathways, either directly (for Rac) or through Dishevelled associated activator of morphogenesis 1 (Daam1) (for Rho and profilin). In addition to cytoskeletal regulation, Rac also controls transcription through activation of JNK. In the Wnt/Ca²⁺ Pathway, binding of Wnt to Frizzled recruits G-proteins that activate Dsh. Several molecules subsequently control Ca²⁺ release from the endoplasmic reticulum, including Protein Kinase G (PKG) that inhibits Ca²⁺ release, and phospholipase C (PLC) that stimulates Ca²⁺ release through the generation of IP₃. Diacylglycerol (DAG), also generated by PLC, together with Ca²⁺, activates protein kinase C (PKC), leading to control of tissue separation through Cdc42. Ventral fate is regulated by the Wnt/Ca²⁺ pathway through the action of calcineurin and nuclear factor of activated T cells (NFAT). The Wnt/Ca²⁺ pathway also inhibits the canonical Wnt pathway through calcium/calmodulin-dependent protein kinase II (CamKII), TAK1, and NEMO. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Wnt proteins regulate many stages of development, from patterning of the embryo and generation of tissues and cell types, to regulation of cell movements, polarity, axon guidance and synapse formation (7-9). Defective Wnt signaling plays major roles in diseases such as cancer and osteoporosis (7). The first step in Wnt signaling is binding of ligand to receptor (Figure 6). Wnt receptors include members of the Frizzled (Fzd) family of seven-pass transmembrane receptors (8), as well as LRP5/LRP6/Arrow (10), which function as co-receptors for Frizzled proteins.  Multiple studies suggest that Wnt ligands bind to both Frizzled and LRP5 (see the record for r18)/6 receptors and induce a complex formation between Frizzled proteins and LRP5/6 (11;12).  Unlike Frizzled receptors, LRP5/6 specifically functions in canonical Wnt signaling.  Canonical Wnt signaling relies on the regulation of the stability/abundance of the β-catenin protein that acts as a nuclear co-activator for the TCF/LEF (T-cell factor/Lymphoid enhancer factor) family of transcription factors (13;14).  In the absence of Wnt signal, cytosolic β-catenin levels are low due to phosphorylation-dependent ubiquitination and subsequent degradation.  β-catenin phosphorylation involves the sequential actions of casein kinase 1 (CK1) and glycogen synthase kinase 3 (GSK3), and takes place in a protein complex assembled by Axin and APC (15).  Phosphorylated β-catenin is then recognized and ubiquitinated by a ubiquitin-ligase complex. Inhibition of β-catenin phosphorylation can occur through several mechanisms; degradation of the Axin protein, alteration of the Axin complex, or inhibition of CK1 or GSK3 activity (10). In the absence of β-catenin, TCF/LEF suppresses Wnt-responsive gene expression by recruiting nuclear corepressors. Upon Wnt stimulation, β-catenin phosphorylation and degradation is inhibited, and β-catenin protein is available to associate with TCF/LEF to activate target gene expression. TCF7L2 is one of several TCF family members (i.e., TCF7L2, TCF7, TCF7L1, and LEF-1) that can interact with β-catenin (1).

TCF7L2 functions in glucose homeostasis by repressing the proglucagon gene in enteroendocrine cells (16;17). In addition, the TCF7L2/β-catenin pathway can activate the transcription of the PKD1 gene. TCF7L2 also regulates proinsulin synthesis as well as processing (and possibly clearance) of proinsulin and insulin (18). Mutations in TCF7L2 are associated with susceptibility to type 2 diabetes mellitus (OMIM: #125853) (19-22). The risk T-allele rs7903146 is associated with impaired glucose-stimulated insulin secretion, and patients with this allele show elevated plasma proinsulin level and an increased proinsulin-to-insulin ratios (23-25).

TCF7L2 regulates adipocyte development and function (26). TCF7L2 silencing blocks adipogenesis by disrupting Wnt signaling (26). TCF7L2 inactivation through deletion of the HMG box results in whole-body glucose intolerance, hepatic insulin resistance, increased subcutaneous adipose tissue mass, adipocyte hypertrophy, and inflammation (26).

TCF7L2 promotes oligodendrocyte differentiation during myelin formation and remyelination by an unknown mechanism (27). Mice with conditional knockout of TCF7L2 in oligodendroglial lineage cells showed shorter riding times on the rotarod during a rotarod performance test compared to control mice (27). The conditional knockout mice showed lack of remyelination in the corpus callosum after treatment with cuprizone, while control mice showed almost complete remyelination.

Tcf7l2-deficient mice are neonatal lethal at birth (28-31). Tcf7l2-deficient embryos exhibited increased numbers of proliferating cells in the intestine (at embryonic day 13.5), but the number of proliferating cells in the colon was decreased compared to wild-type mice (29). Tcf7l2-deficient embryos also had increased combined volumes of the anterior and intermediate pituitary gland lobes (32). Tcf7l2-deficient mice exhibit fragile intestines, increased necrosis of epithelial cells of the small intestine and colon, reduced birth weights, hypoglycemia, and lack of crypt structures due to necrosis (29;30). Heterozygous mice (Tcf7l2^+/-) exhibited reduced body weights, increased circulating glucose levels, reduced circulating insulin levels, and impaired glucose tolerance (31;33). Tcf7l2^+/- mice also showed anxiety-like phenotypes in open field and light dark box tests with concomitant reduced distances traveled in the open field (34). The mice also showed enhanced fear learning. Pancreas-specific Tcf7l2-null mice showed impaired glucose tolerance and impaired insulin secretion (35).

Putative Mechanism

TCF7L2 is expressed along the crypt-villus axis in the small intestine and at high levels in the noncycling cells in the upper colonic crypt (29;36). β-catenin/TCF7L2 controls proliferation versus differentiation in healthy and malignant intestinal epithelial cells through the EphB2/EphB3 (see the record for turtle) and ephrin B1 pathways (37;38). Disruption of β-catenin/TCF7L2 activity in colorectal cancer cells causes G1 arrest and blockade of a genetic program that was physiologically active in the proliferative compartment of colon crypts (37). In some patients with colorectal cancer that have inactivation of the APC gene, beta-catenin accumulates and associates with TCF7L2 to activate TCF7L2-regulated genes (39;40). Mutations in TCF7L2 have been observed in colorectal cancer cell lines (41;42). A VTI1A/TCF7L2 fusion gene has been observed in colorectal cancers (43).

Mice with conditional knockout of TCF7L2 in adult intestine showed total absence of proliferative cells in the small intestinal crypt and the colon (44). TCF7L2 is required for the maintenance of the Lgr5⁺ stem cells in the adult small intestine (44). The phenotype observed in the banned mice indicates loss of TCF7L2-associated function.

Primers

PCR Primer
banned_pcr_F: GGCAAATCAGAGTGGACCTG
banned_pcr_R: TTGGTCACCAGAGACAGAGG

Sequencing Primer
banned_seq_F: TCAGAGTGGACCTGGGAGC
banned_seq_R: TTCCAGCCAGCGAGTTGTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 602 nucleotides is amplified (chromosome 19, + strand):

1   ggcaaatcag agtggacctg ggagcctcac agcccaccga agtcactgct tttaattgct
61  ccgtgacctc gggccatgac ttgcaggggg acatccctta ggtgacatca acttgccgtg
121 agcattagat aactctctcc cctggcgtct ttgcccttta ttcacagaca actctctccc
181 cctgtttcta ggagaaaaaa aaagtgcgtt cgctacatac aaggtgaagg cagctgcctc
241 agcccaccct cttcagatgg aagcttacta gactcgcctc ccccctcacc gcatctgcta
301 ggctcccctc cccaagacgc caagtcacag actgagcaga cccagccgct ctcgctgtcc
361 ctgaagcctg atcctctggc ccacctgtcc atgatgcctc cgccacccgc gctcctgttg
421 gccgaagctg cccacggcaa ggcctctgcc ctctgtccca atggggctct ggacctgcca
481 cctgccgctc tgcagccgtc catggtccct tcctcatcgc tcgcacaacc atcaacttct
541 tccttacatt cccacaactc gctggctgga acgcaacccc agcctctgtc tctggtgacc
601 aa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Prokunina-Olsson, L., Welch, C., Hansson, O., Adhikari, N., Scott, L. J., Usher, N., Tong, M., Sprau, A., Swift, A., Bonnycastle, L. L., Erdos, M. R., He, Z., Saxena, R., Harmon, B., Kotova, O., Hoffman, E. P., Altshuler, D., Groop, L., Boehnke, M., Collins, F. S., and Hall, J. L. (2009) Tissue-Specific Alternative Splicing of TCF7L2. Hum Mol Genet. 18, 3795-3804.

  2. Castrop, J., van Norren, K., and Clevers, H. (1992) A Gene Family of HMG-Box Transcription Factors with Homology to TCF-1. Nucleic Acids Res. 20, 611.

  3. Poy, F., Lepourcelet, M., Shivdasani, R. A., and Eck, M. J. (2001) Structure of a Human Tcf4-Beta-Catenin Complex. Nat Struct Biol. 8, 1053-1057.

  4. Weise, A., Bruser, K., Elfert, S., Wallmen, B., Wittel, Y., Wohrle, S., and Hecht, A. (2010) Alternative Splicing of Tcf7l2 Transcripts Generates Protein Variants with Differential Promoter-Binding and Transcriptional Activation Properties at Wnt/beta-Catenin Targets. Nucleic Acids Res. 38, 1964-1981.

  5. Howng, S. L., Huang, F. H., Hwang, S. L., Lieu, A. S., Sy, W. D., Wang, C., and Hong, Y. R. (2004) Differential Expression and Splicing Isoform Analysis of Human Tcf-4 Transcription Factor in Brain Tumors. Int J Oncol. 25, 1685-1692.

  6. Shiina, H., Igawa, M., Breault, J., Ribeiro-Filho, L., Pookot, D., Urakami, S., Terashima, M., Deguchi, M., Yamanaka, M., Shirai, M., Kaneuchi, M., Kane, C. J., and Dahiya, R. (2003) The Human T-Cell Factor-4 Gene Splicing Isoforms, Wnt Signal Pathway, and Apoptosis in Renal Cell Carcinoma. Clin Cancer Res. 9, 2121-2132.

  7. Logan, C. Y., and Nusse, R. (2004) The Wnt Signaling Pathway in Development and Disease. Annu Rev Cell Dev Biol. 20, 781-810.

  8. Packard, M., Mathew, D., and Budnik, V. (2003) Wnts and TGF Beta in Synaptogenesis: Old Friends Signalling at New Places. Nat Rev Neurosci. 4, 113-120.

  9. Wodarz, A., and Nusse, R. (1998) Mechanisms of Wnt Signaling in Development. Annu Rev Cell Dev Biol. 14, 59-88.

  10. He, X., Semenov, M., Tamai, K., and Zeng, X. (2004) LDL Receptor-Related Proteins 5 and 6 in Wnt/beta-Catenin Signaling: Arrows Point the Way. Development. 131, 1663-1677.

  11. Tamai, K., Semenov, M., Kato, Y., Spokony, R., Liu, C., Katsuyama, Y., Hess, F., Saint-Jeannet, J. P., and He, X. (2000) LDL-Receptor-Related Proteins in Wnt Signal Transduction. Nature. 407, 530-535.

  12. Semenov, M. V., Tamai, K., Brott, B. K., Kuhl, M., Sokol, S., and He, X. (2001) Head Inducer Dickkopf-1 is a Ligand for Wnt Coreceptor LRP6. Curr Biol. 11, 951-961.

  13. Bienz, M., and Clevers, H. (2003) Armadillo/beta-Catenin Signals in the Nucleus--Proof Beyond a Reasonable Doubt? Nat Cell Biol. 5, 179-182.

  14. Cong, F., Schweizer, L., Chamorro, M., and Varmus, H. (2003) Requirement for a Nuclear Function of Beta-Catenin in Wnt Signaling. Mol Cell Biol. 23, 8462-8470.

  15. Ikeda, S., Kishida, S., Yamamoto, H., Murai, H., Koyama, S., and Kikuchi, A. (1998) Axin, a Negative Regulator of the Wnt Signaling Pathway, Forms a Complex with GSK-3beta and Beta-Catenin and Promotes GSK-3beta-Dependent Phosphorylation of Beta-Catenin. EMBO J. 17, 1371-1384.

  16. Yi, F., Brubaker, P. L., and Jin, T. (2005) TCF-4 Mediates Cell Type-Specific Regulation of Proglucagon Gene Expression by Beta-Catenin and Glycogen Synthase Kinase-3beta. J Biol Chem. 280, 1457-1464.

  17. Shao, W., Wang, D., Chiang, Y. T., Ip, W., Zhu, L., Xu, F., Columbus, J., Belsham, D. D., Irwin, D. M., Zhang, H., Wen, X., Wang, Q., and Jin, T. (2013) The Wnt Signaling Pathway Effector TCF7L2 Controls Gut and Brain Proglucagon Gene Expression and Glucose Homeostasis. Diabetes. 62, 789-800.

  18. Zhou, Y., Park, S. Y., Su, J., Bailey, K., Ottosson-Laakso, E., Shcherbina, L., Oskolkov, N., Zhang, E., Thevenin, T., Fadista, J., Bennet, H., Vikman, P., Wierup, N., Fex, M., Rung, J., Wollheim, C., Nobrega, M., Renstrom, E., Groop, L., and Hansson, O. (2014) TCF7L2 is a Master Regulator of Insulin Production and Processing. Hum Mol Genet. 23, 6419-6431.

  19. Reynisdottir, I., Thorleifsson, G., Benediktsson, R., Sigurdsson, G., Emilsson, V., Einarsdottir, A. S., Hjorleifsdottir, E. E., Orlygsdottir, G. T., Bjornsdottir, G. T., Saemundsdottir, J., Halldorsson, S., Hrafnkelsdottir, S., Sigurjonsdottir, S. B., Steinsdottir, S., Martin, M., Kochan, J. P., Rhees, B. K., Grant, S. F., Frigge, M. L., Kong, A., Gudnason, V., Stefansson, K., and Gulcher, J. R. (2003) Localization of a Susceptibility Gene for Type 2 Diabetes to Chromosome 5q34-q35.2. Am J Hum Genet. 73, 323-335.

  20. Duggirala, R., Blangero, J., Almasy, L., Dyer, T. D., Williams, K. L., Leach, R. J., O'Connell, P., and Stern, M. P. (1999) Linkage of Type 2 Diabetes Mellitus and of Age at Onset to a Genetic Location on Chromosome 10q in Mexican Americans. Am J Hum Genet. 64, 1127-1140.

  21. Grant, S. F., Thorleifsson, G., Reynisdottir, I., Benediktsson, R., Manolescu, A., Sainz, J., Helgason, A., Stefansson, H., Emilsson, V., Helgadottir, A., Styrkarsdottir, U., Magnusson, K. P., Walters, G. B., Palsdottir, E., Jonsdottir, T., Gudmundsdottir, T., Gylfason, A., Saemundsdottir, J., Wilensky, R. L., Reilly, M. P., Rader, D. J., Bagger, Y., Christiansen, C., Gudnason, V., Sigurdsson, G., Thorsteinsdottir, U., Gulcher, J. R., Kong, A., and Stefansson, K. (2006) Variant of Transcription Factor 7-Like 2 (TCF7L2) Gene Confers Risk of Type 2 Diabetes. Nat Genet. 38, 320-323.

  22. Sladek, R., Rocheleau, G., Rung, J., Dina, C., Shen, L., Serre, D., Boutin, P., Vincent, D., Belisle, A., Hadjadj, S., Balkau, B., Heude, B., Charpentier, G., Hudson, T. J., Montpetit, A., Pshezhetsky, A. V., Prentki, M., Posner, B. I., Balding, D. J., Meyre, D., Polychronakos, C., and Froguel, P. (2007) A Genome-Wide Association Study Identifies Novel Risk Loci for Type 2 Diabetes. Nature. 445, 881-885.

  23. Saxena, R., Gianniny, L., Burtt, N. P., Lyssenko, V., Giuducci, C., Sjogren, M., Florez, J. C., Almgren, P., Isomaa, B., Orho-Melander, M., Lindblad, U., Daly, M. J., Tuomi, T., Hirschhorn, J. N., Ardlie, K. G., Groop, L. C., and Altshuler, D. (2006) Common Single Nucleotide Polymorphisms in TCF7L2 are Reproducibly Associated with Type 2 Diabetes and Reduce the Insulin Response to Glucose in Nondiabetic Individuals. Diabetes. 55, 2890-2895.

  24. Loder, M. K., da Silva Xavier, G., McDonald, A., and Rutter, G. A. (2008) TCF7L2 Controls Insulin Gene Expression and Insulin Secretion in Mature Pancreatic Beta-Cells. Biochem Soc Trans. 36, 357-359.

  25. Dahlgren, A., Zethelius, B., Jensevik, K., Syvanen, A. C., and Berne, C. (2007) Variants of the TCF7L2 Gene are Associated with Beta Cell Dysfunction and Confer an Increased Risk of Type 2 Diabetes Mellitus in the ULSAM Cohort of Swedish Elderly Men. Diabetologia. 50, 1852-007-0746-5. Epub 2007 Jul 6.

  26. Chen, X., Ayala, I., Shannon, C., Fourcaudot, M., Acharya, N. K., Jenkinson, C. P., Heikkinen, S., and Norton, L. (2018) The Diabetes Gene and Wnt Pathway Effector TCF7L2 Regulates Adipocyte Development and Function. Diabetes. 67, 554-568.

  27. Weng, C., Ding, M., Fan, S., Cao, Q., and Lu, Z. (2017) Transcription Factor 7 Like 2 Promotes Oligodendrocyte Differentiation and Remyelination. Mol Med Rep. 16, 1864-1870.

  28. Korinek, V., Barker, N., Moerer, P., van Donselaar, E., Huls, G., Peters, P. J., and Clevers, H. (1998) Depletion of Epithelial Stem-Cell Compartments in the Small Intestine of Mice Lacking Tcf-4. Nat Genet. 19, 379-383.

  29. Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., and Capecchi, M. R. (2011) T-Cell Factor 4 Functions as a Tumor Suppressor Whose Disruption Modulates Colon Cell Proliferation and Tumorigenesis. Proc Natl Acad Sci U S A. 108, 4914-4919.

  30. Savic, D., Ye, H., Aneas, I., Park, S. Y., Bell, G. I., and Nobrega, M. A. (2011) Alterations in TCF7L2 Expression Define its Role as a Key Regulator of Glucose Metabolism. Genome Res. 21, 1417-1425.

  31. Oh, K. J., Park, J., Kim, S. S., Oh, H., Choi, C. S., and Koo, S. H. (2012) TCF7L2 Modulates Glucose Homeostasis by Regulating CREB- and FoxO1-Dependent Transcriptional Pathway in the Liver. PLoS Genet. 8, e1002986.

  32. Brinkmeier, M. L., Potok, M. A., Cha, K. B., Gridley, T., Stifani, S., Meeldijk, J., Clevers, H., and Camper, S. A. (2003) TCF and Groucho-Related Genes Influence Pituitary Growth and Development. Mol Endocrinol. 17, 2152-2161.

  33. Yang, H., Li, Q., Lee, J. H., and Shu, Y. (2012) Reduction in Tcf7l2 Expression Decreases Diabetic Susceptibility in Mice. Int J Biol Sci. 8, 791-801.

  34. Savic, D., Distler, M. G., Sokoloff, G., Shanahan, N. A., Dulawa, S. C., Palmer, A. A., and Nobrega, M. A. (2011) Modulation ofTcf7l2 Expression Alters Behavior in Mice. PLoS One. 6, e26897.

  35. da Silva Xavier, G., Mondragon, A., Sun, G., Chen, L., McGinty, J. A., French, P. M., and Rutter, G. A. (2012) Abnormal Glucose Tolerance and Insulin Secretion in Pancreas-Specific Tcf7l2-Null Mice. Diabetologia. 55, 2667-2676.

  36. Gregorieff, A., Pinto, D., Begthel, H., Destree, O., Kielman, M., and Clevers, H. (2005) Expression Pattern of Wnt Signaling Components in the Adult Intestine. Gastroenterology. 129, 626-638.

  37. van de Wetering, M., Sancho, E., Verweij, C., de Lau, W., Oving, I., Hurlstone, A., van der Horn, K., Batlle, E., Coudreuse, D., Haramis, A. P., Tjon-Pon-Fong, M., Moerer, P., van den Born, M., Soete, G., Pals, S., Eilers, M., Medema, R., and Clevers, H. (2002) The Beta-catenin/TCF-4 Complex Imposes a Crypt Progenitor Phenotype on Colorectal Cancer Cells. Cell. 111, 241-250.

  38. Batlle, E., Henderson, J. T., Beghtel, H., van den Born, M. M., Sancho, E., Huls, G., Meeldijk, J., Robertson, J., van de Wetering, M., Pawson, T., and Clevers, H. (2002) Beta-Catenin and TCF Mediate Cell Positioning in the Intestinal Epithelium by Controlling the Expression of EphB/ephrinB. Cell. 111, 251-263.

  39. Morin, P. J., Sparks, A. B., Korinek, V., Barker, N., Clevers, H., Vogelstein, B., and Kinzler, K. W. (1997) Activation of Beta-Catenin-Tcf Signaling in Colon Cancer by Mutations in Beta-Catenin Or APC. Science. 275, 1787-1790.

  40. Korinek, V., Barker, N., Morin, P. J., van Wichen, D., de Weger, R., Kinzler, K. W., Vogelstein, B., and Clevers, H. (1997) Constitutive Transcriptional Activation by a Beta-Catenin-Tcf Complex in APC-/- Colon Carcinoma. Science. 275, 1784-1787.

  41. Duval, A., Gayet, J., Zhou, X. P., Iacopetta, B., Thomas, G., and Hamelin, R. (1999) Frequent Frameshift Mutations of the TCF-4 Gene in Colorectal Cancers with Microsatellite Instability. Cancer Res. 59, 4213-4215.

  42. Duval, A., Rolland, S., Tubacher, E., Bui, H., Thomas, G., and Hamelin, R. (2000) The Human T-Cell Transcription Factor-4 Gene: Structure, Extensive Characterization of Alternative Splicings, and Mutational Analysis in Colorectal Cancer Cell Lines. Cancer Res. 60, 3872-3879.

  43. Bass, A. J., Lawrence, M. S., Brace, L. E., Ramos, A. H., Drier, Y., Cibulskis, K., Sougnez, C., Voet, D., Saksena, G., Sivachenko, A., Jing, R., Parkin, M., Pugh, T., Verhaak, R. G., Stransky, N., Boutin, A. T., Barretina, J., Solit, D. B., Vakiani, E., Shao, W., Mishina, Y., Warmuth, M., Jimenez, J., Chiang, D. Y., Signoretti, S., Kaelin, W. G.,Jr, Spardy, N., Hahn, W. C., Hoshida, Y., Ogino, S., DePinho, R. A., Chin, L., Garraway, L. A., Fuchs, C. S., Baselga, J., Tabernero, J., Gabriel, S., Lander, E. S., Getz, G., and Meyerson, M. (2011) Genomic Sequencing of Colorectal Adenocarcinomas Identifies a Recurrent VTI1A-TCF7L2 Fusion. Nat Genet. 43, 964-968.

  44. van Es, J. H., Haegebarth, A., Kujala, P., Itzkovitz, S., Koo, B. K., Boj, S. F., Korving, J., van den Born, M., van Oudenaarden, A., Robine, S., and Clevers, H. (2012) A Critical Role for the Wnt Effector Tcf4 in Adult Intestinal Homeostatic Self-Renewal. Mol Cell Biol. 32, 1918-1927.