Phenotypic Mutation 'Dani_alves'

• Allele: Dani_alves
• Mutation Type: missense
• Chromosome: 9
• Coordinate: 119,166,889 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Myd88
• Gene Name: myeloid differentiation primary response gene 88
• Chromosomal Location: 119,165,000-119,169,084 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Phenylalanine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000035092] [ENSMUSP00000115746]
• AlphaFold: P22366
• SMART Domains: Protein: ENSMUSP00000035092; Gene: ENSMUSG00000032508; AA Change: V223F

Domain	Start	End	E-Value	Type
DEATH	19	109	7.17e-15	SMART
TIR	160	296	3.39e-25	SMART

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
  (Using ENSMUST00000035092)
• SMART Domains: Protein: ENSMUSP00000115746; Gene: ENSMUSG00000032508

Domain	Start	End	E-Value	Type
Pfam:Death	50	109	3.5e-13	PFAM

• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.6383
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:41 PM by Katherine Timer
• Record Created: 2017-02-03 9:00 AM
• Record Posted: 2017-04-13
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Cristhiaan Ochoa, Lei Sun, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010851; MGI:108005

Alleles Listed at MGI

All Mutations and Alleles(24) : Chemically induced (ENU)(5) Gene trapped(4) Targeted(12) Transgenic(3)

Phenotypic Description

Figure 1. Dani_alves mice exhibited decreased TNFα secretion in response to TLR9 ligand, CpG ODN. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dani_alves mice exhibited decreased TNFα secretion in response to TLR7 ligand, R848. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dani_alves phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5091, some of which showed reduced TNFα secretion in response to the TLR9 ligand CpG oligodeoxynucleotides (CpG ODN) primed with IFNγ (Figure 1) and the TLR7 ligand R848 (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced TNFα secretion after CpG ODN stimulation using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R5091. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 64 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Myd88: a G to T transversion at base pair 119,337,823 (v38) on chromosome 9, or base pair 2,218 in the GenBank genomic region NC_000075 encoding Myd88. The strongest association was found with an additive model of inheritance to the TLR9 defect, wherein four variant homozygotes and 11 heterozygous mice departed phenotypically from three homozygous reference mice with a P value of 5.252 x 10^-5 (Figure 3).  

The mutation corresponds to residue 748 in the mRNA sequence NM_010851 within exon 4 of 6 total exons.

733 CGCATGGTGGTGGTTGTTTCTGACGATTATCTA 218 -R--M--V--V--V--V--S--D--D--Y--L-

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to phenylalanine (F) substitution at position 223 (V223F) in the MYD88 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.693).

Protein Prediction

Figure 4. MyD88 is a 296 amino acid protein adapter. It contains an N-terminal death domain (DD) that acts as a protein-protein interaction domain that mediates homotypic interactions with other death domain-containing proteins in order to propagate signaling. The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins. The C-terminal portion of MyD88 contains a Toll/IL-1 receptor (TIR) domain, a conserved region which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs, IL receptors and the adapters MyD88 and TIRAP contain three conserved boxes (boxes 1, 2 and 3), which are required for signaling. Between the death domain and TIR domain is an “intermediate domain” that may be required for differential activation of distinct NF-κB- versus JNK-dependent transcriptional programs. The Dani_alves mutation results results in a valine (V) to phenylalanine (F) substitution at position 223 (V223F). This image is interactive. Click on the image to view other mutations found in MyD88 (red). Click on the mutations for more specific information.

MyD88 is a 296 amino acid protein adapter that relays signals from the IL-1 and IL-18 receptors and from most TLRs. It is a modular protein containing an N-terminal death domain encoded by the first exon (aa 1-109), which shares similarity with regions of the p55 tumor necrosis factor receptor type I and Fas antigen receptor (Figure 4). The death domain of MyD88 is required for binding to IL-1 receptor associated kinase (IRAK) family proteins (1). Following the MyD88 death domain is an “intermediate domain” encoded by exon 2. The C-terminal portion of MyD88 (exons 3-5) contains a Toll/IL-1 receptor (TIR) domain (1;2), a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction.

The Dani_alves mutation results in a valine (V) to phenylalanine (F) substitution at position 223 (V223F) in the MYD88 protein. Amino acid 223 is within the TIR domain.

Please see the record for pococurante for information about Myd88.

Putative Mechanism

Figure 5. MyD88 signaling pathways. MyD88 is a protein adapter that relays signals from the IL-1 and IL-8 receptors (not shown) and from most TLRs. Activation of these receptors leads to MyD88 recruitment to the receptor complexes, where it recruits IRAK family proteins, first IRAK-4 and then IRAK-1, as well as TRAF6. The signaling pathway culminates in the activation of NF-κB-dependent transcription. MyD88 and TRAF6 may interact directly with IRF5 in a complex, activating IRF5 and promoting its translocation to the nucleus. MyD88, together with TRAF6 and IRAK4, has also been shown to bind IRF7 directly. This occurs downstream of TLR7, TLR8 and TLR9 in plasmacytoid dendritic cells and requires the phosphorylation of IRF7 by IRAK1.

The function of MyD88 in IL-1R and TLR signaling has been confirmed using MyD88-deficient mice. Myd88^-/- mice display no response to IL-1, including T cell proliferation or cytokine induction, and fail to activate NF-κB (4). In TLR signaling, MyD88 is known to serve all the TLRs except for TLR3. Thus, TLR2/1, TLR2/6, TLR5, TLR7 and TLR9 signaling leading to activation of NF-κB is abolished in MyD88-deficient mice.

Primers

PCR Primer
Dani_alves_pcr_F: TACATAAGGAAGTACACAGGTCCG
Dani_alves_pcr_R: CCATTGCCAGCGAGCTAATTG

Sequencing Primer
Dani_alves_seq_F: AGGTCCGTCCTCAGAGATCTGTAG
Dani_alves_seq_R: TTGGTTAAACATCTAAGAGGGTAGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 9, - strand):

1   ccattgccag cgagctaatt gagaaaaggt tggttaaaca tctaagaggg taggtgggtg
61  aatgcatgaa acccagaggt ccagatgcaa ggactgtcct gctagctggg ctctgtcccg
121 cctgggtaat gtagtccttc ctgaccccat cctctgaagg aagtcaccgc agtgccactc
181 tccctcaggt gtcgccgcat ggtggtggtt gtttctgacg attatctaca gagcaaggaa
241 tgtgacttcc agaccaagtt tgcactcagc ctgtctccag gtaagcttag gcctgctttg
301 gtcaaagaga gagtagagat atagccttag gatgatagtc caggaatgca aaaccaaagc
361 actacagatc tctgaggacg gacctgtgta cttccttatg ta

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

   1.  Wesche, H., Henzel, W. J., Shillinglaw, W., Li, S., and Cao, Z. (1997) MyD88: an adapter that recruits IRAK to the IL-1 receptor complex, Immunity 7, 837-847.

   2.  Rand, D. M., Dorfsman, M., and Kann, L. M. (1994) Neutral and non-neutral evolution of Drosophila mitochondrial DNA, Genetics 138, 741-756.

   3.  Hardiman, G., Rock, F. L., Balasubramanian, S., Kastelein, R. A., and Bazan, J. F. (1996) Molecular characterization and modular analysis of human MyD88, Oncogene 13, 2467-2475.

 4.  Adachi, O., Kawai, T., Takeda, K., Matsumoto, M., Tsutsui, H., Sakagami, M., Nakanishi, K., and Akira, S. (1998) Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function., Immunity 9, 143-150.