Phenotypic Mutation 'splenda2' (pdf version)
Allelesplenda2
Mutation Type missense
Chromosome19
Coordinate54,046,639 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Adra2a
Gene Name adrenergic receptor, alpha 2a
Synonym(s) alpha2A-AR, Adra-2a, Adra-2, alpha2A, alpha2A-adrenergic receptor, alpha(2A)AR
Chromosomal Location 54,045,182-54,048,982 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene fail to produce hypotensive responsiveness to alpha2AR agonists, including failure to inhibit voltage-gated Ca2+ currents and spontaneous neuronal firing. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007417; MGI:87934

MappedYes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036203]
AlphaFold Q01338
SMART Domains Protein: ENSMUSP00000036203
Gene: ENSMUSG00000033717
AA Change: I142T

DomainStartEndE-ValueType
Pfam:7tm_4 55 237 1.5e-7 PFAM
Pfam:7TM_GPCR_Srx 56 188 2.5e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 245 3.7e-7 PFAM
Pfam:7tm_1 65 441 1.5e-73 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000036700)
Meta Mutation Damage Score 0.6666 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotype question? Literature verified References
30 min GTT hypoglycemic 17964569
30 min GTT hypoglycemic (female) 17964569
30 min GTT hypoglycemic (male) 17964569
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.836; ML prob: 0.778; human score: 4
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Targeted(5) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
splenda UTSW 19 54046495 missense probably damaging 1.00
R0245:Adra2a UTSW 19 54047409 missense probably damaging 1.00
R1933:Adra2a UTSW 19 54046406 missense probably damaging 1.00
R2175:Adra2a UTSW 19 54046362 missense probably benign 0.04
R4553:Adra2a UTSW 19 54046735 missense possibly damaging 0.86
R4781:Adra2a UTSW 19 54046495 missense probably damaging 1.00
R4984:Adra2a UTSW 19 54046639 missense probably damaging 1.00
R5260:Adra2a UTSW 19 54046608 missense probably damaging 1.00
R5326:Adra2a UTSW 19 54046681 missense probably damaging 1.00
R5585:Adra2a UTSW 19 54046239 missense probably benign 0.00
R6861:Adra2a UTSW 19 54046387 missense probably damaging 1.00
R7290:Adra2a UTSW 19 54046404 missense probably damaging 1.00
R7677:Adra2a UTSW 19 54046944 missense probably damaging 1.00
R7836:Adra2a UTSW 19 54046228 missense probably benign 0.41
R8997:Adra2a UTSW 19 54047298 missense probably benign 0.04
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2021-11-10 12:13 PM by Diantha La Vine
Record Created 2017-02-07 8:34 PM
Record Posted 2018-12-19
Phenotypic Description

Figure 1. Splenda2 mice exhibited decreased glucose levels in response to glucose challenge. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The splenda2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4984, some of which showed diminished glucose levels 30 minutes after glucose challenge (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hypoglycemic phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R4984. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. The hypoglycemia phenotype was linked by continuous variable mapping to a mutation in Adra2a: a T to C transition at base pair 54,046,639 (v38) on chromosome 19, or base pair 1,458 in the GenBank genomic region NC_000085 encoding Adra2a. Linkage was found with an additive model of inheritance, wherein eight variant homozygotes and 30 heterozygous mice departed phenotypically from 11 homozygous reference mice with a P value of 7.121 x 10-5 (Figure 2).  

 

The mutation corresponds to residue 1,458 in the mRNA sequence NM_007417 within exon 1 of 1 total exons.

 

1442 GTGCACCTGTGCGCCATCAGCCTTGACCGCTAC

137  -V--H--L--C--A--I--S--L--D--R--Y-

 

The mutated nucleotide is indicated in red. The mutation results in an isoleucine to threonine substitution at amino acid 142 (I142T) in the ADRA2A protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Topology of α2AAR. α2AAR has seven transmembrane (TM) domains. Other mutations found in the α2AAR protein are noted in red. 

Adra2a encodes the alpha-2a adrenergic receptor (α2AAR). The adrenergic receptors are G protein-coupled receptor (GPCRs). GPCRs consist of seven transmembrane-spanning α-helices connected by alternating intracellular (C-) and extracellular (E-) loops (Figure 3). The N-terminus is located on the extracellular side and the C-terminus on the intracellular side (1). Adrenergic, adenosine, and rhodopsin (see the record for Bemr3) belong to the class A subfamily of GPCRs, which are characterized by a highly conserved (E/D)RY motif at the cytoplasmic end of the third transmembrane helix (TM3) (1). Many GPCRs also contain an NPXXY motif located in the TM7, and a stabilizing Cys-Cys disulfide bond (2)

 

The second and third intracellular loops interact with G protein-coupled receptor kinase-2 (GRK2) (3;4). In addition to mediating an interaction with GRK2, the third intracellular loop also interacts with arrestins (5;6), heterotrimeric G proteins (7), spinophilin (8), and 14-3-3 (9). The second and third intracellular loops and the juxtamembrane regions of the third cytoplasmic loop putatively regulate coupling to G-proteins (10-13). The third intracellular loop also functions in α2AAR stabilization at the cell surface (14). The N-terminus of the third intracellular loop regulates agonist-associated downregulation of α2AAR (15).

 

The splenda2 mutation results in an isoleucine to threonine substitution at amino acid 142 (I142T); I142 is within the cytoplasmic loop between transmembrane domains three and four.

 

Please see the record for splenda for more information about Adra2a.

Putative Mechanism

Adra2a is highly expressed in the brain, including the locus ceruleus, midbrain, hypothalamus, amygdala, hippocampus, spinal cord, cerebral cortex, cerebellum, septum, and brain stem (16-18). The α2AAR is also expressed in human platelets, β cells of the pancreas, adrenal gland, intestinal epithelia, vascular endothelium, and smooth muscle cells (19). The α2AAR The α2AAR is localized to both the pre- and post-synapse (19).

 

The α2-adrenergic receptors (α2AAR, α2BAR, and α2CAR) mediate decreases in adenylyl cyclase activity, activation of receptor-mediated K+ channels, and inhibition of voltage-gated Ca2+ channels by coupling to Gi and Go proteins (20). α2AAR can also stimulate Gs proteins (21). The α2-adrenergic receptors have critical roles in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. α2AAR is the main inhibitory presynaptic feedback receptor (22-24). α2A and α2C served as heteroreceptors to inhibit the release of dopamine an serotonin in the central nervous system (25;26).

 

α2AAR activation inhibits insulin secretion from pancreatic islets; increased expression of ADRA2A depresses insulin release (27). α2AAR inhibits insulin secretion by modulating cAMP levels after being activated by neuronal norepinephrine, circulating epinephrine, or by spontaneous activation. α2AAR activation results in receptor- Gi coupling and subsequent inhibition of adenylyl cyclase, reduced conversion of ATP to cAMP, and reduced protein kinase A-mediated exocytosis of insulin granules (28).

 

Mutations in human ADRA2A have been linked with increased fasting glucose levels and reduced insulin secretion during glucose challenge as well as obesity, high blood pressure, and increased type 2 diabetes risk (27;29-31). Adra2a-deficient (Adra2a-/-) mice exhibit reduced fasted circulating glucose levels, increased plasma insulin and glucagon levels, improved glucose tolerance, reduced startle reflex, and reduced prepulse inhibition [(32) and MGI:5695965]. Glucose-stimulated insulin secretion was not increased in the Adra2a-/-mice (32).

 

The phenotype of the splenda2 mice is similar to that of Adra2a-/-mice, indicating loss of α2AAR-associated function in regulating insulin secretion from pancreatic islets (27).

Primers PCR Primer
splenda2_pcr_F: TTATCGCGGTGTTCACCAGTC
splenda2_pcr_R: TGATCTTGCAGCTTGGCTCG

Sequencing Primer
splenda2_seq_F: TCGCGCGCTCAAAGCTC
splenda2_seq_R: CCACACGGTGACAATGA
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 408 nucleotides is amplified (chromosome 19, + strand):

 

 

1   ttatcgcggt gttcaccagt cgcgcgctca aagctcccca aaacctcttc ctggtgtccc
61  tggcctcagc ggacatcctg gtggccacgc tggtcattcc cttttctttg gccaacgagg
121 ttatgggtta ctggtacttt ggtaaggtgt ggtgtgagat ctatttggct ctcgacgtgc
181 tcttttgcac gtcgtccata gtgcacctgt gcgccatcag ccttgaccgc tactggtcca
241 tcacgcaggc catcgagtac aacctgaagc gcacgccgcg tcgcatcaag gccatcattg
301 tcaccgtgtg ggtcatctcg gctgtcatct ccttcccgcc actcatctcc atagagaaga
361 agggcgctgg cggcgggcag cagccggccg agccaagctg caagatca

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler