Phenotypic Mutation 'Dum_dum'

• Allele: Dum_dum
• Mutation Type: makesense
• Chromosome: 8
• Coordinate: 11,037,012 bp (GRCm39)
• Base Change: A ⇒ C (forward strand)
• Gene: Irs2
• Gene Name: insulin receptor substrate 2
• Synonym(s): Irs-2
• Chromosomal Location: 11,034,681-11,058,458 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Stop codon changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000038514]
• AlphaFold: P81122
• PDB Structure: Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION] ; Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION] ; Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000038514; Gene: ENSMUSG00000038894; AA Change: *1322G

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	19	28	N/A	INTRINSIC
PH	31	146	2.83e-13	SMART
IRS	191	293	4.98e-38	SMART
PTBI	191	293	2.24e-51	SMART
low complexity region	301	309	N/A	INTRINSIC
low complexity region	364	377	N/A	INTRINSIC
low complexity region	435	473	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	688	710	N/A	INTRINSIC
low complexity region	721	730	N/A	INTRINSIC
low complexity region	834	846	N/A	INTRINSIC
low complexity region	923	959	N/A	INTRINSIC
low complexity region	976	984	N/A	INTRINSIC
low complexity region	997	1028	N/A	INTRINSIC
low complexity region	1137	1154	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC
low complexity region	1274	1296	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.8526
• Is this an essential gene?: Possibly essential (E-score: 0.528)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-02-20 8:22 PM
• Record Posted: 2018-10-24
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001081212; MGI:109334

Alleles Listed at MGI

All Mutations and Alleles(7) : Targeted(6) Transgenic(1)

Phenotypic Description

Figure 1. Dum_dum mice exhibited high insulin 30 minutes after glucose challenge. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dum_dum mice exhibited high fasting glucose levels. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Dum_dum mice exhibited low residual glucose levels. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Dum_dum phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5022 in which some mice showed high insulin 30 minutes after glucose challenge (Figure 1) fasting hyperglycemia (Figure 2), and a decrease in the level of 30 minute glucose residual levels (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the fasting glucose levels using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 111 mutations (X-axis) identified in the G1 male of pedigree R5022. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 111 mutations. All of the above abnormalities were linked by continuous variable mapping to a mutation in Irs2: a T to G transversion at base pair 10,987,012 (v38) on chromosome 8, or base pair 21,420 in the GenBank genomic region NC_000074 encoding Irs2. The strongest association was found with a recessive model of inheritance to the fasting glucose levels, wherein six variant homozygotes departed phenotypically from eight homozygous reference mice and 15 heterozygous mice with a P value of 2.481 x 10^-6 (Figure 4). A semidominant model of inheritance was observed in the insulin level assay after glucose challenge (P = 2.856 x 10^-6).

The mutation corresponds to residue 3,964 in the mRNA sequence NM_001081212 within exon 2 of 2 total exons.

3949 ACAGTCGTGAAAGAGTGAGCGCTACCAGCCCCATCGCCGCCATGTTGA…… 1317 -T--V--V--K--E--*-

The mutated nucleotide is indicated in red. The putative novel stop codon is in blue. The mutation results in substitution of the stop codon at position 1,322 to a glycine (*1322G) in the IRS2 protein. The next potential stop codon is 30-base pairs following the original site, putatively after coding 10 aberrant amino acids.

Protein Prediction

Figure 5. Domain organization of IRS2. The Dum-dum mutation results in substitution of the stop codon at position 1,322 to a glycine in the IRS2 protein. The next potential stop codon is 30-base pairs following the original site, putatively after coding 10 aberrant amino acids.

Figure 6. Crystal structure of human PH-PTB in IRS1. UCSF Chimera model is based on PDB 1QQG, Dhe-Paganon, et al. Proc.Natl.Acad.Sci.USA. 96, 8378-8383 (1999). Click on the 3D structure to view it rotate.

Irs2 encodes insulin receptor substate-2 (IRS2), one of four members of the IRS family (IRS1 through IRS4). The IRS proteins consist of N-terminal pleckstrin homology (PH) and phosphotyrosine binding (PTB) domains followed by long, unstructured C-terminal tails containing numerous tyrosine, serine, and threonine residues [Figure 5; reviewed in (1)]. IRS1 (see the record for runt) and IRS2 have highly similar PH and PTB domains; the two proteins function analogously in insulin receptor (IR; see the record for gummi_bear) signaling (2). IRS1 and IRS2 differ within their respective tail regions. The PH and PTB domains of IRS1 interact with the activated IR and are therefore necessary for insulin-stimulated tyrosine phosphorylation of IRS1 (3-6). Both domains fold into a seven-stranded, antiparallel β-sandwich capped at one end by an α-helix [Figure 6; PDB:1QQG; (7;8)]. The PTB domain binds to the juxtamembrane region of the IR (8); in vitro binding experiments showed that the IRS1 PTB recognizes an NPXpY sequence motif with a hydrophobic residue at pY−8 (6;9). The IRS1 PH domain binds to phosphatidylinositol phosphates, an interaction that may help bring IRS1 to the IR at the cell membrane (7).

IRS1 and IRS2 are regulated by phosphorylation of more than 50 serine/threonine residues within their long, unstructured C-terminal tails (1;10). Depending on the sites affected and the time course of phosphorylation, phosphorylation can have positive or negative regulatory effects on IRS function.

The Dum_dum mutation results in substitution of the stop codon at position 1,322 to a glycine (*1322G) in the IRS2 protein.

Please see the record runt (Irs1) for more information about the IRS proteins.

Expression/Localization

Both IRS1 and IRS2 are widely expressed in mammalian tissues. IRS1 is predicted to predominantly function in skeletal muscle and fat, and IRS2 predominantly functions in the liver.

Background

Figure 7. Binding of insulin to the insulin receptor (IR) propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways. Insulin binding to the IR promotes autophosphorylation of the receptor. IRS1/2 recruitment to the IR results in PI3K and GRB2 activation. Activated PI3K phosphorylates membrane phospholipids, the major product being phosphatidylinositol-3,4,5-trisphosphate (PIP₃). PIP₃ in turn activates PIP₃-dependent kinase 1 (PDK1). PDK1 activates another kinase called protein kinase B (PKB; alternatively, AKT). Insulin-mediated activation of AKT2/PKBβ results in inhibition of lipolysis and gluoconeogenesis as well as activation of protein and glycogen synthesis. PDK1 phosphorylates some isoforms of protein kinase C (PKC). The PKC isoform, PKCλ/ζ, phosphorylates proteins associated with intracellular vesicles containing the glucose transporter, GLUT4, resulting in their migration to and fusion with, the plasma membrane and subsequent increased glucose uptake and metabolism in adipose tissue. GRB2 activation results in signal transduction via the monomeric G-protein, RAS. Activation of RAS ultimately leads to changes in the expression of numerous genes via activation of members of the extracellular signal-regulated kinases, ERK.

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids (Figure 7). Binding of insulin to the ectodomain of the IR activates the insulin signaling pathway by triggering a conformational change that facilitates IR autophosphorylation of the kinase domain. Phosphorylation of the kinase activation loop stimulates IR catalytic activity. Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., IRS1, IRS2, and Shc [see the record for shrine (Shc2)]). IRS1 and IRS2 do not have intrinsic enzyme activity, but function as docking proteins that bind and activate signal transduction proteins (11). Activated IR propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways (12). The PI3K pathway, activated by IRS proteins, mediates the metabolic functions of insulin through effectors such as GSK3β, mTORC1, mTORC2, and Forkhead transcription factors. Shc activates the Shc-Grb2-Sos-Ras-Raf-MAPK pathway, which controls cellular proliferation and gene transcription. Of four mammalian IRS proteins, IRS1 and IRS2 are the main substrates phosphorylated by the IR in response to insulin binding. Tyrosine phosphorylated IRS1 and IRS2 act as scaffolding proteins that recruit SH2 domain-containing proteins including the p85 regulatory subunit of class 1A PI3K (see the record for anubis) (13). For more information about IR-associated signaling, please the record for gummi_bear.

Whether a p.G1057D mutation in IRS2 is associated with noninsulin-dependent diabetes mellitus (OMIM: #125853) is unclear. One study found a strong association between type II diabetes in Italian patients and the mutation (14), but another study in Italian patients found that the p.G1057D mutation did not affect insulin secretion and insulin sensitivity (15).

Systemic knockout of either IRS1 or IRS2 in mice leads to hyperinsulinemia, impaired glucose tolerance, and reduced insulin sensitivity (16-19). However, distinct phenotypes are also observed in Irs1^-/- and Irs2^-/- mice.  Irs1^-/- mice display growth retardation (50 to 60% of WT weight) and their insulin resistance is compensated by β cell hyperplasia so that fasting blood glucose levels are normal in 4-8 week old mice (16;17). Irs1^-/- mice also showed higher blood pressures and plasma triglyceride levels with concomitant reduced levels of lipoprotein lipase activity than wild-type mice (20).  In contrast, Irs2^-/- mice show mild growth retardation (90% of WT weight) and develop diabetes due to a lack of β cell compensation for insulin resistance (18). Irs2^-/- female mice were infertile, with anovulatory ovaries and reduced numbers of follicles (21). The Irs2^-/- female mice also showed increased food intake and obesity (21).

Primers

PCR Primer
Dum_dum_pcr_F: AGCCCGTCAGTTCACAAAGG
Dum_dum_pcr_R: CACAGATGGTTGCTGGGAAG

Sequencing Primer
Dum_dum_seq_F: GGTTCCTTATCTAATTCACAGAAGTC
Dum_dum_seq_R: TTACTGGAATGCTTGGCAAAAAGTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 560 nucleotides is amplified (chromosome 8, - strand):

1   cacagatggt tgctgggaag gcaagaaccc ttgcctaatc ctctgaattt gtttgtttgt
61  ttgttttgtt ttactggaat gcttggcaaa aagtgtgtgt gtgtgtgtag acttttctca
121 cttgtgtgta ccctgccacc ccaactctag gaccttgcgt ttgcatctct gagtacctca
181 tttcggagga aagtacccac cctgatcaca ggtccatggg ttaagagtgc cttttggttc
241 ttagagcctg gctcaccagt tttcttctct ctttttcaga gtgaagcgct accagcccca
301 tcgccgccat gttgaaaaaa acaaaaacaa aaacaaaaca aaaaaaacaa aactctgaat
361 ccattcgaag gagatgcttg gcatgtttcc gaccaacgct gctgctcact ttcctatcaa
421 cgggagcaat tctacatttt gagacttctg tgaattagat aaggaaccaa gaggcaggtc
481 tgcctctcag ctgtccccac acaccagccc tcatcgcacg gtttgtgttg cattttgttt
541 cctttgtgaa ctgacgggct 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Copps, K. D., and White, M. F. (2012) Regulation of Insulin Sensitivity by serine/threonine Phosphorylation of Insulin Receptor Substrate Proteins IRS1 and IRS2. Diabetologia. 55, 2565-2582.

  2. Sun, X. J., Wang, L. M., Zhang, Y., Yenush, L., Myers, M. G.,Jr, Glasheen, E., Lane, W. S., Pierce, J. H., and White, M. F. (1995) Role of IRS-2 in Insulin and Cytokine Signalling. Nature. 377, 173-177.

  3. Yenush, L., Makati, K. J., Smith-Hall, J., Ishibashi, O., Myers, M. G.,Jr, and White, M. F. (1996) The Pleckstrin Homology Domain is the Principal Link between the Insulin Receptor and IRS-1. J Biol Chem. 271, 24300-24306.

  4. Myers, M. G.,Jr, Grammer, T. C., Brooks, J., Glasheen, E. M., Wang, L. M., Sun, X. J., Blenis, J., Pierce, J. H., and White, M. F. (1995) The Pleckstrin Homology Domain in Insulin Receptor Substrate-1 Sensitizes Insulin Signaling. J Biol Chem. 270, 11715-11718.

  5. Voliovitch, H., Schindler, D. G., Hadari, Y. R., Taylor, S. I., Accili, D., and Zick, Y. (1995) Tyrosine Phosphorylation of Insulin Receptor Substrate-1 in Vivo Depends upon the Presence of its Pleckstrin Homology Region. J Biol Chem. 270, 18083-18087.

  6. Wolf, G., Trub, T., Ottinger, E., Groninga, L., Lynch, A., White, M. F., Miyazaki, M., Lee, J., and Shoelson, S. E. (1995) PTB Domains of IRS-1 and Shc have Distinct but Overlapping Binding Specificities. J Biol Chem. 270, 27407-27410.

  7. Dhe-Paganon, S., Ottinger, E. A., Nolte, R. T., Eck, M. J., and Shoelson, S. E. (1999) Crystal Structure of the Pleckstrin Homology-Phosphotyrosine Binding (PH-PTB) Targeting Region of Insulin Receptor Substrate 1. Proc Natl Acad Sci U S A. 96, 8378-8383.

  8. Eck, M. J., Dhe-Paganon, S., Trub, T., Nolte, R. T., and Shoelson, S. E. (1996) Structure of the IRS-1 PTB Domain Bound to the Juxtamembrane Region of the Insulin Receptor. Cell. 85, 695-705.

  9. He, W., O'Neill, T. J., and Gustafson, T. A. (1995) Distinct Modes of Interaction of SHC and Insulin Receptor Substrate-1 with the Insulin Receptor NPEY Region Via Non-SH2 Domains. J Biol Chem. 270, 23258-23262.

  10. Boura-Halfon, S., and Zick, Y. (2009) Phosphorylation of IRS Proteins, Insulin Action, and Insulin Resistance. Am J Physiol Endocrinol Metab. 296, E581-91.

  11. Sun, X. J., Rothenberg, P., Kahn, C. R., Backer, J. M., Araki, E., Wilden, P. A., Cahill, D. A., Goldstein, B. J., and White, M. F. (1991) Structure of the Insulin Receptor Substrate IRS-1 Defines a Unique Signal Transduction Protein. Nature. 352, 73-77.

  12. Khan, A. H., and Pessin, J. E. (2002) Insulin Regulation of Glucose Uptake: A Complex Interplay of Intracellular Signalling Pathways. Diabetologia. 45, 1475-1483.

  13. Sun, X. J., Crimmins, D. L., Myers, M. G.,Jr, Miralpeix, M., and White, M. F. (1993) Pleiotropic Insulin Signals are Engaged by Multisite Phosphorylation of IRS-1. Mol Cell Biol. 13, 7418-7428.

  14. Mammarella, S., Romano, F., Di Valerio, A., Creati, B., Esposito, D. L., Palmirotta, R., Capani, F., Vitullo, P., Volpe, G., Battista, P., Della Loggia, F., Mariani-Costantini, R., and Cama, A. (2000) Interaction between the G1057D Variant of IRS-2 and Overweight in the Pathogenesis of Type 2 Diabetes. Hum Mol Genet. 9, 2517-2521.

  15. D'Alfonso, R., Marini, M. A., Frittitta, L., Sorge, R., Frontoni, S., Porzio, O., Mariani, L. M., Lauro, D., Gambardella, S., Trischitta, V., Federici, M., Lauro, R., and Sesti, G. (2003) Polymorphisms of the Insulin Receptor Substrate-2 in Patients with Type 2 Diabetes. J Clin Endocrinol Metab. 88, 317-322.

  16. Araki, E., Lipes, M. A., Patti, M. E., Bruning, J. C., Haag, B.,3rd, Johnson, R. S., and Kahn, C. R. (1994) Alternative Pathway of Insulin Signalling in Mice with Targeted Disruption of the IRS-1 Gene. Nature. 372, 186-190.

  17. Tamemoto, H., Kadowaki, T., Tobe, K., Yagi, T., Sakura, H., Hayakawa, T., Terauchi, Y., Ueki, K., Kaburagi, Y., and Satoh, S. (1994) Insulin Resistance and Growth Retardation in Mice Lacking Insulin Receptor Substrate-1. Nature. 372, 182-186.

  18. Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., Zhang, Y., Bernal, D., Pons, S., Shulman, G. I., Bonner-Weir, S., and White, M. F. (1998) Disruption of IRS-2 Causes Type 2 Diabetes in Mice. Nature. 391, 900-904.

  19. Kido, Y., Burks, D. J., Withers, D., Bruning, J. C., Kahn, C. R., White, M. F., and Accili, D. (2000) Tissue-Specific Insulin Resistance in Mice with Mutations in the Insulin Receptor, IRS-1, and IRS-2. J Clin Invest. 105, 199-205.

  20. Abe, H., Yamada, N., Kamata, K., Kuwaki, T., Shimada, M., Osuga, J., Shionoiri, F., Yahagi, N., Kadowaki, T., Tamemoto, H., Ishibashi, S., Yazaki, Y., and Makuuchi, M. (1998) Hypertension, Hypertriglyceridemia, and Impaired Endothelium-Dependent Vascular Relaxation in Mice Lacking Insulin Receptor Substrate-1. J Clin Invest. 101, 1784-1788.

  21. Burks, D. J., Font de Mora, J., Schubert, M., Withers, D. J., Myers, M. G., Towery, H. H., Altamuro, S. L., Flint, C. L., and White, M. F. (2000) IRS-2 Pathways Integrate Female Reproduction and Energy Homeostasis. Nature. 407, 377-382.