Phenotypic Mutation 'Park8'

• Allele: Park8
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 59,457,025 bp (GRCm39)
• Base Change: G ⇒ C (forward strand)
• Gene: Nlrp3
• Gene Name: NLR family, pyrin domain containing 3
• Synonym(s): Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
• Chromosomal Location: 59,432,395-59,457,781 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008] ; PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Proline
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000078440] [ENSMUSP00000098707]
• AlphaFold: Q8R4B8
• SMART Domains: Protein: ENSMUSP00000078440; Gene: ENSMUSG00000032691; AA Change: R1013P

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
  (Using ENSMUST00000079476)
• SMART Domains: Protein: ENSMUSP00000098707; Gene: ENSMUSG00000032691; AA Change: R1013P

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
  (Using ENSMUST00000101148)
• Meta Mutation Damage Score: 0.0898
• Is this an essential gene?: Probably nonessential (E-score: 0.079)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Sperm
• Last Updated: 2019-09-04 9:41 PM by Diantha La Vine
• Record Created: 2017-02-23 9:36 PM by Hexin Shi
• Record Posted: 2017-03-03
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Hexin Shi and Bruce Beutler

Accession Number

NCBI RefSeq: NM_145827; MGI:2653833

Alleles Listed at MGI

All Mutations and Alleles(22) : Chemically induced (ENU)(10) Chemically induced (other)(1) Targeted(11)

Phenotypic Description

Figure 1. Park8 mice exhibited diminished IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Park8 phenotype was identified among N-nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R5051, some of which showed  reduced secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced IL-1β secretion after nigericin treatment using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R5051. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. The impaired inflammasome response was linked by continuous variable mapping to a mutation in Nlrp3: a G to C transversion at base pair 59,566,199 (v38) on chromosome 11, or base pair 24,631 in the GenBank genomic region NC_000077. Linkage was found with a dominant model of inheritance (P = 6.751 x 10^-8), wherein four variant homozygotes and 16 heterozygotes departed phenotypically from 15 homozygous reference mice (Figure 2).  

The mutation corresponds to residue 3,264 in the mRNA sequence NM_145827 within exon 10 of 10 total exons.

3248 AATCGTGAAACAAAACGTGCCTTAGAAGCGCTC 1008 -N--R--E--T--K--R--A--L--E--A--L-

The mutated nucleotide is indicated in red.  The mutation results in an arginine to proline substitution at position 1,013 (R1013P) in the NLRP3 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.195).

Protein Prediction

Figure 3. Domain structure of NLRP3. Shown are the pyrin domain (PYD), NACHT domain, NACHT-associated domain (NAD), and leucine-rich repeat (LRR) domain. Together, the NACHT and NAD domains are known as the nucleotide-binding domain (NBD). The Park8 mutation results in an arginine to proline substitution at position 1,013. This image is interactive. Other mutations found in NLRP3 are noted in red. Click on each mutation for more specific information.

The Nlrp3 gene encodes a 1,033 amino acid protein that is a member of the nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) or CATERPILLER [for CARD, transcription enhancer, R(purine)-binding, pyrin, lots of leucine repeats] family [Figure 3; (1)]. NLRP3 has a pyrin domain (PYD) at the N-terminus (amino acids 1-91). NLRP3 has a C-terminal leucine-rich repeat (LRR) domain (amino acids 739-988), a central oligomerization NACHT usually with a C-terminal extension known as the NACHT associated domain (NAD) that together comprise a nucleotide-binding domain (NBD; amino acids 216-532), and an N-terminal effector domain. The N-terminus of NLRP3 contains a pyrin domain (PYD; amino acids 1-91). The Park8 mutation results in an arginine to proline substitution at position 1,013 (R1013P); Arg1013 is within an undefined region following the LRR domains.

For more information about Nlrp3, please see the record for ND1.

Putative Mechanism

NLRP3 is able to oligomerize through its NBD domain and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. A large variety of agents have been shown to activate the NLRP3 inflammasome, and NLRP3 plays an important role in the innate immune response. Mutations within the NBD have been shown to reduce ATP binding, as well as NLRP3 protein function including caspase-1 activation, IL-1β production, cell death, macromolecular complex formation, self-association, and association with apoptosis-associated speck-like protein (ASC). The phenotype of the Park8 mice suggests that the mutated protein, if expressed, is inactive or has reduced activity.  

Primers

PCR Primer
Park8_pcr_F: TGCCTAGAGCTTCTCATGGG
Park8_pcr_R: ATTTGGTCCCACACAAGCC

Sequencing Primer
Park8_seq_F: CCTAGAGCTTCTCATGGGGTAGG
Park8_seq_R: CCTCGGCTGTGATCCTGATG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 400 nucleotides is amplified (chromosome 11, + strand):

1   tgcctagagc ttctcatggg gtaggcgagc ggggtgctga ggggagggtg accacgggac
61  aaaagtcaga gtttctctgg attaatttgc agttttctga agagtccaac tcaaagcttc
121 ttttctgtgt tcacaggttg ggtgaaatgt acttaaatcg tgaaacaaaa cgtgccttag
181 aagcgctcca ggaagaaaag cctgagctga ctatagtctt cgagatttcc tggtaggcgt
241 ggaagcagga ccaccaggtg cctcggtcct gccccaagtc ctgccccaag ccccagtgcg
301 cactgctctt cactgctatc aagccctcct tcaccatcag gatcacagcc gaggctcttc
361 tggtataggg tctggagcaa aggcttgtgt gggaccaaat 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.