Phenotypic Mutation 'Thump'

• Allele: Thump
• Mutation Type: nonsense
• Chromosome: 13
• Coordinate: 118,010,441 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Hcn1
• Gene Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
• Synonym(s): C630013B14Rik, HAC2, hyperpolarization-activated, cyclic nucleotide-gated K+ 1, Bcng1
• Chromosomal Location: 117,738,856-118,117,564 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011] ; PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Lysine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000006991]
• AlphaFold: O88704
• PDB Structure: Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000006991; Gene: ENSMUSG00000021730; AA Change: K340*

Domain	Start	End	E-Value	Type
Pfam:Ion_trans_N	87	130	8.2e-24	PFAM
Pfam:Ion_trans	131	394	2.1e-23	PFAM
low complexity region	395	406	N/A	INTRINSIC
Blast:cNMP	407	439	4e-13	BLAST
cNMP	464	580	1.95e-22	SMART
low complexity region	639	655	N/A	INTRINSIC
low complexity region	660	680	N/A	INTRINSIC
low complexity region	720	779	N/A	INTRINSIC
low complexity region	878	886	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:41 PM by Anne Murray
• Record Created: 2017-02-24 2:09 PM
• Record Posted: 2018-11-16
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Samantha Teixeira and Bruce Beutler

Accession Number

NCBI RefSeq: NM_010408; MGI:1096392

Alleles Listed at MGI

All Mutations and Alleles(6) : Targeted(6)

Phenotypic Description

Figure 1. Thump mice exhibited a reduction in heart rate at day 2 of testing . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Thump mice exhibited a reduction in heart rate at day 3 of testing . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Thump mice exhibited a reduction in average heart rates . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Thump phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5144, some of which showed a reduction in heart rate at days 2 (Figure 1) and 3 (Figure 2) of testing as well as an overall reduced average heart rate (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the average heart rate phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R5144. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Hcn1: an A to T transversion at base pair 117,873,905 (v38) on chromosome 13, or base pair 271,586 in the GenBank genomic region NC_000079 encoding Hcn1. The strongest association was found with an additive model of inheritance to the reduced average heart rate phenotype, wherein five homozygous variant mice and 30 heterozygous mice departed phenotypically from 20 homozygous reference mice with a P value of 7.482 x 10^-9 (Figure 4).  

The mutation corresponds to residue 1,402 in the mRNA sequence NM_010408 within exon 4 of 8 total exons.

1387 TCCTACGCACTCTTCAAAGCTATGAGTCACATG 335 -S--Y--A--L--F--K--A--M--S--H--M-

The mutated nucleotide is indicated in red. The mutation results in substitution of lysine 340 for a premature stop codon (K340*) in the HCN1 protein.

Protein Prediction

Figure 5. HCN1 structure. A, Domain organization. B, Topography. C, Crystal structure of human HCN1. UCSF Chimera model is based on PDB 5U6O . The cyclic nucleotide-binding domain (CNBD) is in an unsolved portion of the protein. The location of the Thump mutation is indicated. The C-linker consists of six α-helices: A' to F', and the CNBD domain consists of α-helices A, B, and C. Domain and topology information is from SMART and UniProt.

Figure 6. Structure of human HCN1 homotetramer. Protein is colored as in Figure 5. The inset shows the top view of the channel. UCSF Chimera model is based on PDB 5U6O, Lee and MacKinnon. Cell. 168, 111-120.e11 (2017). Click on the 3D structure to view it rotate.

Hcn1 encodes hyperpolarization-activated cyclic nucleotide-gated (HCN) channel 1 (HCN1). The HCN channels (i.e., HCN1, HCN2 (see the record for curveball), HCN3, and HCN4) are members of the voltage-gated potassium ion channel superfamily that are primarily expressed in neurons and heart cells (1). The HCN proteins share 80 to 90 percent sequence identity between transmembrane domain one and the end of the cyclic nucleotide-binding domain (CNBD) (Figure 5). Most differences between the HCN proteins are at the N- and C-termini. The HCN channels form complexes of four HCN subunits (homo- and heterotetramers) arranged around a central pore (Figure 6) (2-5).

HCN1 has an HCN domain, six transmembrane domains (S1 through S6), a charged voltage sensor in S4, a pore-lining P loop between S5 and S6, a C-linker, a C-terminal CNBD, and a PDZ-binding domain [Figures 5 and 6; PDB:5U6P; (5;6)]. The 45 to 50 amino acids preceding S1 form a three α-helical domain (termed the HCN domain) that is wedged between the voltage sensor and the cytoplasmic domains. The HCN domain contacts the S4 helix (near the short S4–S5 linker) from the same subunit as well as the C-linker and CNBD from an adjacent subunit. The HCN domain is putatively involved in intersubunit interactions and in the formation of functional channels (7). S6 forms a right-handed, tightly packed bundle within the membrane’s inner leaflet (5). At the level of the intracellular membrane-water interface the S6 helix makes a sharp bend and transitioning to a helix-turn-helix. The pore region contains a GYG motif, which is an ion selectivity filter (8). The HCN1 gate is closed by a tightly packed inner helical bundle that constricts the pore to a radius of about 1 Å at amino acid positions Val390, Thr394, and Gln398. The C-linker domain forms an α-helical disk just below the membrane and connects the CNBD to the transmembrane domains. The CNBD is comprised of five short α-helices and a β-jelly roll and is docked onto the cytoplasmic face of the C-linker disk (5;9). The CNBD mediates modulation by cyclic nucleotides (10).

The C-linker and CNBD together are referred to as the cAMP-sensing domain. Cyclic adenosine monophosphate (cAMP) is the physiological agonist of HCN1 (11;12). cAMP shifts the voltage activation range of HCN1 in the positive direction (11;13;14). Binding of cyclic nucleotides to the CNBD of HCN1 results in conformational changes that stabilize its open state (10;11;14). The cyclic nucleotides bind HCN1 between the β-roll and the C-helix (12). Upon cAMP binding, the C-helix moves in toward the β-roll (9;15;16).

HCN1, 2, and 4 have a PDZ-binding domain in the C-terminal tail that mediates interactions with PDZ-containing proteins and the chaperone TRIP8b (17-20). Association with TRIP8b regulates HCN1 trafficking and inhibits gating through interaction with HCN1 at two C-terminal sites: the PDZ-binding domain and the C-linker-CNBD region (20). The C-linker-CNBD/TRIP8b interaction is necessary and sufficient to enable TRIP8b to downregulate channel surface expression and inhibit channel gating. The PDZ-binding domain/TRIP8b interaction stabilizes the C-terminal domain of TRIP8b, allowing for optimal interaction between HCN1 and TRIP8b. HCN1 interacts with filamin A via a 22-amino acid sequence downstream of the CNBD (21;22). Filamin A is an actin-binding scaffold protein that links HCN1 to the actin cytoskeleton. Filamin A putatively causes clustering and slows down the activation and deactivation kinetics of HCN1 (21;23).

Protein kinase A phosphorylation of the HCN channels stimulates HCN current after β-adrenergic receptor stimulation in early cardiomyogenesis (24). Protein kinase C (PKC)-mediated phosphorylation of the HCN channels results in reduced HCN current and HCN1 surface expression in hippocampal neurons (25). Src tyrosine kinases phosphorylate HCN1, HCN2, and HCN4 in mature cardiac cells and neurons, stimulating HCN function (26-28). Calcium/calmodulin-dependent protein kinase II (29) and p38 mitogen-activated protein kinase (30) phosphorylate the HCN channels in neuronal cells.

The Thump mutation results in substitution of lysine 340 for a premature stop codon (K340*); Lys340 is within the pore-forming P loop.

Expression/Localization

The HCN channels are widely expressed in peripheral and central nervous system neurons and cardiac tissues [reviewed in (31)]. More specifically, HCN1 is expressed in the olfactory bulb, cerebral cortex, hippocampus, superior colliculus, spinal cord, dorsal root ganglion, and cerebellum of the mouse (32;33). In neurons, HCN1 is predominantly expressed in distal dendrites. In the heart, HCN1 is highly expressed in the sinoatrial node. HCN1 is also expressed in photoreceptor inner segments (34;35) and cochlear hair cells (22).

Background

Figure 7. HCN1 channel. Each subunit of the HCN1 channel forms 6 transmembrane segments (S1–S6). S4 is a positively charged voltage sensor. The pore region is between S5 and S6. (Two subunits of the channel are shown for clarity.) CNBD in the cytoplasm and mediates modulation through cAMP. The HCN channels allow Na + and K + to enter, creating an I h current in the brain and an I f current in the heart).

Figure 8. The phototransduction cycle in rod cells. In the dark, opsin is bound to 11-cis-retinal to form inactive rhodopsin (R) in the disc membranes. Basal activity of the guanylyl cyclase (GC) keeps cGMP levels high. The binding of Ca²⁺-bound calmodulin (CaM) confers high affinity for cGMP to cGMP-gated channels in the plasma membrane, allowing these channels to remain open. Both Na⁺ and Ca²⁺enter the channels resulting in high Ca²⁺ levels and Ca²⁺-bound guanylate cyclase-activating protein (GCAP). Light (hv) results in photoisomerization of 11-cis-retinal to all-trans-retinal, forming activated rhodopsin (R^*), which binds and activates the heterotrimeric G protein, transducin (αβγ). The GTP-bound transducin α subunit activates cGMP phosphodiesterase (PDE), which hydrolyzes cGMP to GMP, reducing the cGMP concentration and the binding of cGMP to the cGMP-gated channels. The probability of channel closing increases proportional to light intensity, reducing Ca²⁺ influx. Intracellular Ca²⁺ is further depleted by activity of the Na⁺-Ca²⁺, K⁺exchanger. Low intracellular Ca²⁺ leads to active GCAP, which in turn activates GC to synthesize cGMP from GTP supplied by the guanine nucleotide cycle. This comprises guanylate kinase (GK) and nucleoside diphosphate kinase (NDPK). Release of Ca²⁺ from CaM leads to its dissociation from the cGMP-gated channels conferring a lower affinity from cGMP and further closure of the channels. This image is interactive. Other mutations found in the pathway are noted in red. Click on each mutation for more information.HCNs promote synaptic integration, neuronal excitability, and the formation of resting membrane potentials in the central and peripheral nervous systems as well as cardiac nodal cell pacemaker activity (6;36). The HCN channels generate inward current (I_h in the brain and I_f/I_q in the heart) (Figure 7). I_h is a Na⁺/K⁺ current when the membrane potential is hyperpolarized, producing rhythmic electrical activity in neurons and in cardiac sinoatrial node (SAN) cells; see the “Putative Mechanism” section for more information about HCN1 function in SAN cells. In neurons, the I_h currents regulate the determination of resting membrane potential, action potential firing rate, dendritic integration, and synaptic transmission (37).

HCNs promote synaptic integration, neuronal excitability, and the formation of resting membrane potentials in the central and peripheral nervous systems as well as cardiac nodal cell pacemaker activity (6;36). The HCN channels generate inward current (I_h in the brain and I_f/I_q in the heart) (Figure 7). I_h is a Na⁺/K⁺ current when the membrane potential is hyperpolarized, producing rhythmic electrical activity in neurons and in cardiac sinoatrial node (SAN) cells; see the “Putative Mechanism” section for more information about HCN1 function in SAN cells. In neurons, the I_h currents regulate the determination of resting membrane potential, action potential firing rate, dendritic integration, and synaptic transmission (37).

Retina photoreceptor cells are specialized neurons that absorb photons from the field of view and signal this information through a change in membrane potential. Both rod and cone cells have the same basic structure with an axon terminal located closest to the visual field, an organelle containing cell body, followed by a mitochondrial-rich inner segment and finally the outer segment, which contains the light-absorbing materials. The chief function of the inner segment is to provide ATP for the sodium-potassium pump that maintains the cell membrane potential. The outer segments are modified cilia that contain disks filled with opsin (see the record bemr3 for information about rhodopsin), as well as voltage-gated sodium channels. Rod cells differ from cone cells not only in the type of opsin they contain, but also in the amount of opsin as the sensitivity of rod cells to light is provided in part by the large amounts of rhodopsin they contain in their outer segments. Visual phototransduction is a process by which light is converted into electrical signals in the rod cells, cone cells and photosensitive ganglion cells in the retina. This process is initiated by the absorption of photons and isomerization of 11-cis-retinal into all-trans-retinal, resulting in rhodopsin activation (Figure 8). The first step of the phototransduction cascade is the transitory binding of photoactivated rhodopsin (Rho*) and transducin, a heterotrimeric G protein that alternates between an inactive guanosine diphosphate (GDP) and an active guanosine triphosphate (GTP) bound state. The GDP form of transducin docks onto the Rho* surface, and GDP then dissociates from the complex allowing GTP to bind to transducin. GTP-bound transducin then dissociates from Rho*, interacts with the γ subunits of the cyclic GMP (cGMP) phosphodiesterase PDE6, which activates the catalytic α or β subunits and results in hydrolysis of cGMP. Depletion of cGMP in the ROS results in closure of cGMP-gated channels in the plasma membrane and hyperpolarization of the photoreceptor cell, which prevents the release of neurotransmitters. HCN1 shapes and shortens photoreceptor voltage responses (38;39). Hyperpolarization of the plasma membrane after closure of the CNG channels in the outer segment induces opening of HCN1. An inward current through the open HCN1 channels reduces the level of the hyperpolarization. Loss of HCN1 expression results in sustained high rod signals for a prolonged period of time (40). Hcn1^-/- mice showed exaggerated, prolonged rod photoreceptor responses as determined by electroretinography as well as a reduced flicker (train of flashes) fusion frequency (35;40).

Mutations in HCN1 are associated with early infantile epileptic encephalopathy-24 (EIEE24; OMIM: #615871) (41;42). Patients with EIEE24 exhibit pharmacoresistant febrile seizures between 4 and 13 months of age as well as intellectual disability of varying degrees, behavioral disturbances, autistic features, and ataxia (42).

Hcn1-deficient (Hcn1^-/-) mice are overtly healthy, but exhibit learned motor skill deficits in a rotarod test and increased thigmotaxis (i.e., remain close to walls) in a water maze test (43). Hcn1^-/- mice showed susceptibility to limbic seizure induction by amygdala kindling, kainic acid, or pilocarpine administration whereby the mice showed higher seizure severity and higher seizure-related mortality than wild-type mice (44;45). Hcn1^-/- mice also showed reduced cold allodynia after partial sciatic nerve ligation (46). Hcn1^-/- mice also showed less sensitive auditory brainstem responses as well as lower baseline acoustic startle responses (47). Mice with conditional Hcn1 knockout in the forebrain exhibited increased hippocampal-dependent learning and memory as well as enhanced long-term potentiation at the direct perforant path input to the distal dendrites of CA1 pyramidal neurons (48). Cerebellar Purkinje cell-specific HCN1 knockout mice showed defects in late stages of motor learning (49).

Putative Mechanism

The heartbeat is initiated and maintained by the generation of spontaneous action potentials in the pacemaker cells of the SAN region in the right atrial endocardium. Several ion channels (calcium, potassium, and sodium) function in the maintenance of the SAN action potential. Among those, HCN channels are involved in the hyperpolarization-activated current. Three member of the HCN family have been identified in pacemaker cells: HCN1, 2 and 4. HCN4 is responsible for 70% of hyperpolarization-activated current (50). The I_f controls heart rate, and is activated by a membrane potential more negative than -50 mV (Figure 7). Several factors can increase the I_f, including catecholamines, adrenaline, and noradrenaline. Blockage of the I_f current reduces the heart rate by up to 20 to 30 percent. Hcn1^-/- mice have reduced beating frequency in isolated pacemaker cells, in intact SAN, and in the whole heart as well as reduced cardiac output (69% of wild-type) (50). The heart rate phenotype of the Thump mice indicates loss of HCN1-related function in the heart. Overt neurological phenotypes were not observed, and retinal function was not assessed in the Thump mice.

Primers

PCR Primer
Thump_pcr_F: CTAGGCTCACATGAACAAAAGG
Thump_pcr_R: ACTGCCTCCTTGAAGAGTCC

Sequencing Primer
Thump_seq_F: GCATTTGGTTAGCATCCAGTTAGAAG
Thump_seq_R: TGCCTCCTTGAAGAGTCCAAAGAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 426 nucleotides is amplified (chromosome 13, + strand):

1   ctaggctcac atgaacaaaa ggtgatgttc ttcctgtttt atcttaatag gccatatttg
61  aatatcattg gggcatttgg ttagcatcca gttagaagtt atgctaattg ctgctttcca
121 tacttgttac ttcccaatgc ttatgctgat aagttttact tattttgcct tttattaccc
181 taatatctca gttaattttt tcttctctca tgtttcagaa tgattcctgg ggaaaacaat
241 attcctacgc actcttcaaa gctatgagtc acatgctgtg cattggttat ggcgcccaag
301 cccctgtcag catgtctgac ctctggatta ccatgctgag catgattgtg ggcgccacct
361 gctacgcaat gtttgttggc catgccacag ctttgatcca gtctttggac tcttcaagga
421 ggcagt

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Santoro, B., Grant, S. G., Bartsch, D., and Kandel, E. R. (1997) Interactive Cloning with the SH3 Domain of N-Src Identifies a New Brain Specific Ion Channel Protein, with Homology to Eag and Cyclic Nucleotide-Gated Channels. Proc Natl Acad Sci U S A. 94, 14815-14820.

  2. Whitaker, G. M., Angoli, D., Nazzari, H., Shigemoto, R., and Accili, E. A. (2007) HCN2 and HCN4 Isoforms Self-Assemble and Co-Assemble with Equal Preference to Form Functional Pacemaker Channels. J Biol Chem. 282, 22900-22909.

  3. Altomare, C., Terragni, B., Brioschi, C., Milanesi, R., Pagliuca, C., Viscomi, C., Moroni, A., Baruscotti, M., and DiFrancesco, D. (2003) Heteromeric HCN1-HCN4 Channels: A Comparison with Native Pacemaker Channels from the Rabbit Sinoatrial Node. J Physiol. 549, 347-359.

  4. Ulens, C., and Tytgat, J. (2001) Functional Heteromerization of HCN1 and HCN2 Pacemaker Channels. J Biol Chem. 276, 6069-6072.

  5. Lee, C. H., and MacKinnon, R. (2017) Structures of the Human HCN1 Hyperpolarization-Activated Channel. Cell. 168, 111-120.e11.

  6. Santoro, B., Liu, D. T., Yao, H., Bartsch, D., Kandel, E. R., Siegelbaum, S. A., and Tibbs, G. R. (1998) Identification of a Gene Encoding a Hyperpolarization-Activated Pacemaker Channel of Brain. Cell. 93, 717-729.

  7. Tran, N., Proenza, C., Macri, V., Petigara, F., Sloan, E., Samler, S., and Accili, E. A. (2002) A Conserved Domain in the NH2 Terminus Important for Assembly and Functional Expression of Pacemaker Channels. J Biol Chem. 277, 43588-43592.

  8. Macri, V., Angoli, D., and Accili, E. A. (2012) Architecture of the HCN Selectivity Filter and Control of Cation Permeation. Sci Rep. 2, 894.

  9. Zagotta, W. N., Olivier, N. B., Black, K. D., Young, E. C., Olson, R., and Gouaux, E. (2003) Structural Basis for Modulation and Agonist Specificity of HCN Pacemaker Channels. Nature. 425, 200-205.

  10. Wainger, B. J., DeGennaro, M., Santoro, B., Siegelbaum, S. A., and Tibbs, G. R. (2001) Molecular Mechanism of cAMP Modulation of HCN Pacemaker Channels. Nature. 411, 805-810.

  11. Craven, K. B., and Zagotta, W. N. (2006) CNG and HCN Channels: Two Peas, One Pod. Annu Rev Physiol. 68, 375-401.

  12. DeBerg, H. A., Brzovic, P. S., Flynn, G. E., Zagotta, W. N., and Stoll, S. (2016) Structure and Energetics of Allosteric Regulation of HCN2 Ion Channels by Cyclic Nucleotides. J Biol Chem. 291, 371-381.

  13. Emery, E. C., Young, G. T., Berrocoso, E. M., Chen, L., and McNaughton, P. A. (2011) HCN2 Ion Channels Play a Central Role in Inflammatory and Neuropathic Pain. Science. 333, 1462-1466.

  14. Robinson, R. B., and Siegelbaum, S. A. (2003) Hyperpolarization-Activated Cation Currents: From Molecules to Physiological Function. Annu Rev Physiol. 65, 453-480.

  15. Flynn, G. E., Black, K. D., Islas, L. D., Sankaran, B., and Zagotta, W. N. (2007) Structure and Rearrangements in the Carboxy-Terminal Region of SpIH Channels. Structure. 15, 671-682.

  16. Puljung, M. C., DeBerg, H. A., Zagotta, W. N., and Stoll, S. (2014) Double Electron-Electron Resonance Reveals cAMP-Induced Conformational Change in HCN Channels. Proc Natl Acad Sci U S A. 111, 9816-9821.

  17. Santoro, B., Wainger, B. J., and Siegelbaum, S. A. (2004) Regulation of HCN Channel Surface Expression by a Novel C-Terminal Protein-Protein Interaction. J Neurosci. 24, 10750-10762.

  18. Kimura, K., Kitano, J., Nakajima, Y., and Nakanishi, S. (2004) Hyperpolarization-Activated, Cyclic Nucleotide-Gated HCN2 Cation Channel Forms a Protein Assembly with Multiple Neuronal Scaffold Proteins in Distinct Modes of Protein-Protein Interaction. Genes Cells. 9, 631-640.

  19. Pan, Y., Bhattarai, S., Modestou, M., Drack, A. V., Chetkovich, D. M., and Baker, S. A. (2014) TRIP8b is Required for Maximal Expression of HCN1 in the Mouse Retina. PLoS One. 9, e85850.

  20. Santoro, B., Hu, L., Liu, H., Saponaro, A., Pian, P., Piskorowski, R. A., Moroni, A., and Siegelbaum, S. A. (2011) TRIP8b Regulates HCN1 Channel Trafficking and Gating through Two Distinct C-Terminal Interaction Sites. J Neurosci. 31, 4074-4086.

  21. Gravante, B., Barbuti, A., Milanesi, R., Zappi, I., Viscomi, C., and DiFrancesco, D. (2004) Interaction of the Pacemaker Channel HCN1 with Filamin A. J Biol Chem. 279, 43847-43853.

  22. Ramakrishnan, N. A., Drescher, M. J., Khan, K. M., Hatfield, J. S., and Drescher, D. G. (2012) HCN1 and HCN2 Proteins are Expressed in Cochlear Hair Cells: HCN1 can Form a Ternary Complex with Protocadherin 15 CD3 and F-Actin-Binding Filamin A Or can Interact with HCN2. J Biol Chem. 287, 37628-37646.

  23. Noam, Y., Ehrengruber, M. U., Koh, A., Feyen, P., Manders, E. M., Abbott, G. W., Wadman, W. J., and Baram, T. Z. (2014) Filamin A Promotes Dynamin-Dependent Internalization of Hyperpolarization-Activated Cyclic Nucleotide-Gated Type 1 (HCN1) Channels and Restricts Ih in Hippocampal Neurons. J Biol Chem. 289, 5889-5903.

  24. Abi-Gerges, N., Ji, G. J., Lu, Z. J., Fischmeister, R., Hescheler, J., and Fleischmann, B. K. (2000) Functional Expression and Regulation of the Hyperpolarization Activated Non-Selective Cation Current in Embryonic Stem Cell-Derived Cardiomyocytes. J Physiol. 523 Pt 2, 377-389.

  25. Williams, A. D., Jung, S., and Poolos, N. P. (2015) Protein Kinase C Bidirectionally Modulates Ih and Hyperpolarization-Activated Cyclic Nucleotide-Gated (HCN) Channel Surface Expression in Hippocampal Pyramidal Neurons. J Physiol. 593, 2779-2792.

  26. Yu, H. G., Lu, Z., Pan, Z., and Cohen, I. S. (2004) Tyrosine Kinase Inhibition Differentially Regulates Heterologously Expressed HCN Channels. Pflugers Arch. 447, 392-400.

  27. Zong, X., Eckert, C., Yuan, H., Wahl-Schott, C., Abicht, H., Fang, L., Li, R., Mistrik, P., Gerstner, A., Much, B., Baumann, L., Michalakis, S., Zeng, R., Chen, Z., and Biel, M. (2005) A Novel Mechanism of Modulation of Hyperpolarization-Activated Cyclic Nucleotide-Gated Channels by Src Kinase. J Biol Chem. 280, 34224-34232.

  28. Arinsburg, S. S., Cohen, I. S., and Yu, H. G. (2006) Constitutively Active Src Tyrosine Kinase Changes Gating of HCN4 Channels through Direct Binding to the Channel Proteins. J Cardiovasc Pharmacol. 47, 578-586.

  29. Shin, M., and Chetkovich, D. M. (2007) Activity-Dependent Regulation of h Channel Distribution in Hippocampal CA1 Pyramidal Neurons. J Biol Chem. 282, 33168-33180.

  30. Poolos, N. P., Bullis, J. B., and Roth, M. K. (2006) Modulation of h-Channels in Hippocampal Pyramidal Neurons by p38 Mitogen-Activated Protein Kinase. J Neurosci. 26, 7995-8003.

  31. Ramirez, D., Zuniga, R., Concha, G., and Zuniga, L. (2018) HCN Channels: New Therapeutic Targets for Pain Treatment. Molecules. 23, 10.3390/molecules23092094.

  32. Moosmang, S., Biel, M., Hofmann, F., and Ludwig, A. (1999) Differential Distribution of Four Hyperpolarization-Activated Cation Channels in Mouse Brain. Biol Chem. 380, 975-980.

  33. Santoro, B., Chen, S., Luthi, A., Pavlidis, P., Shumyatsky, G. P., Tibbs, G. R., and Siegelbaum, S. A. (2000) Molecular and Functional Heterogeneity of Hyperpolarization-Activated Pacemaker Channels in the Mouse CNS. J Neurosci. 20, 5264-5275.

  34. Muller, F., Scholten, A., Ivanova, E., Haverkamp, S., Kremmer, E., and Kaupp, U. B. (2003) HCN Channels are Expressed Differentially in Retinal Bipolar Cells and Concentrated at Synaptic Terminals. Eur J Neurosci. 17, 2084-2096.

  35. Knop, G. C., Seeliger, M. W., Thiel, F., Mataruga, A., Kaupp, U. B., Friedburg, C., Tanimoto, N., and Muller, F. (2008) Light Responses in the Mouse Retina are Prolonged upon Targeted Deletion of the HCN1 Channel Gene. Eur J Neurosci. 28, 2221-2230.

  36. Nolan, M. F., Malleret, G., Lee, K. H., Gibbs, E., Dudman, J. T., Santoro, B., Yin, D., Thompson, R. F., Siegelbaum, S. A., Kandel, E. R., and Morozov, A. (2003) The Hyperpolarization-Activated HCN1 Channel is Important for Motor Learning and Neuronal Integration by Cerebellar Purkinje Cells. Cell. 115, 551-564.

  37. He, C., Chen, F., Li, B., and Hu, Z. (2014) Neurophysiology of HCN Channels: From Cellular Functions to Multiple Regulations. Prog Neurobiol. 112, 1-23.

  38. Demontis, G. C., Longoni, B., Barcaro, U., and Cervetto, L. (1999) Properties and Functional Roles of Hyperpolarization-Gated Currents in Guinea-Pig Retinal Rods. J Physiol. 515 ( Pt 3), 813-828.

  39. Fain, G. L., Quandt, F. N., Bastian, B. L., and Gerschenfeld, H. M. (1978) Contribution of a Caesium-Sensitive Conductance Increase to the Rod Photoresponse. Nature. 272, 466-469.

  40. Sothilingam, V., Michalakis, S., Garcia Garrido, M., Biel, M., Tanimoto, N., and Seeliger, M. W. (2016) HCN1 Channels Enhance Rod System Responsivity in the Retina Under Conditions of Light Exposure. PLoS One. 11, e0147728.

  41. Baruscotti, M., Bottelli, G., Milanesi, R., DiFrancesco, J. C., and DiFrancesco, D. (2010) HCN-Related Channelopathies. Pflugers Arch. 460, 405-415.

  42. Nava, C., Dalle, C., Rastetter, A., Striano, P., de Kovel, C. G., Nabbout, R., Cances, C., Ville, D., Brilstra, E. H., Gobbi, G., Raffo, E., Bouteiller, D., Marie, Y., Trouillard, O., Robbiano, A., Keren, B., Agher, D., Roze, E., Lesage, S., Nicolas, A., Brice, A., Baulac, M., Vogt, C., El Hajj, N., Schneider, E., Suls, A., Weckhuysen, S., Gormley, P., Lehesjoki, A. E., De Jonghe, P., Helbig, I., Baulac, S., Zara, F., Koeleman, B. P., EuroEPINOMICS RES Consortium, Haaf, T., LeGuern, E., and Depienne, C. (2014) De Novo Mutations in HCN1 Cause Early Infantile Epileptic Encephalopathy. Nat Genet. 46, 640-645.

  43. Nolan, M. F., Malleret, G., Lee, K. H., Gibbs, E., Dudman, J. T., Santoro, B., Yin, D., Thompson, R. F., Siegelbaum, S. A., Kandel, E. R., and Morozov, A. (2003) The Hyperpolarization-Activated HCN1 Channel is Important for Motor Learning and Neuronal Integration by Cerebellar Purkinje Cells. Cell. 115, 551-564.

  44. Santoro, B., Lee, J. Y., Englot, D. J., Gildersleeve, S., Piskorowski, R. A., Siegelbaum, S. A., Winawer, M. R., and Blumenfeld, H. (2010) Increased Seizure Severity and Seizure-Related Death in Mice Lacking HCN1 Channels. Epilepsia. 51, 1624-1627.

  45. Huang, Z., Walker, M. C., and Shah, M. M. (2009) Loss of Dendritic HCN1 Subunits Enhances Cortical Excitability and Epileptogenesis. J Neurosci. 29, 10979-10988.

  46. Momin, A., Cadiou, H., Mason, A., and McNaughton, P. A. (2008) Role of the Hyperpolarization-Activated Current Ih in Somatosensory Neurons. J Physiol. 586, 5911-5929.

  47. Ison, J. R., Allen, P. D., and Oertel, D. (2017) Deleting the HCN1 Subunit of Hyperpolarization-Activated Ion Channels in Mice Impairs Acoustic Startle Reflexes, Gap Detection, and Spatial Localization. J Assoc Res Otolaryngol. 18, 427-440.

  48. Nolan, M. F., Malleret, G., Dudman, J. T., Buhl, D. L., Santoro, B., Gibbs, E., Vronskaya, S., Buzsaki, G., Siegelbaum, S. A., Kandel, E. R., and Morozov, A. (2004) A Behavioral Role for Dendritic Integration: HCN1 Channels Constrain Spatial Memory and Plasticity at Inputs to Distal Dendrites of CA1 Pyramidal Neurons. Cell. 119, 719-732.

  49. Rinaldi, A., Defterali, C., Mialot, A., Garden, D. L., Beraneck, M., and Nolan, M. F. (2013) HCN1 Channels in Cerebellar Purkinje Cells Promote Late Stages of Learning and Constrain Synaptic Inhibition. J Physiol. 591, 5691-5709.

  50. Fenske, S., Krause, S. C., Hassan, S. I., Becirovic, E., Auer, F., Bernard, R., Kupatt, C., Lange, P., Ziegler, T., Wotjak, C. T., Zhang, H., Hammelmann, V., Paparizos, C., Biel, M., and Wahl-Schott, C. A. (2013) Sick Sinus Syndrome in HCN1-Deficient Mice. Circulation. 128, 2585-2594.