Phenotypic Mutation 'Thump' (pdf version)
List |< first << previous [record 9 of 132] next >> last >|
AlleleThump
Mutation Type nonsense
Chromosome13
Coordinate117,873,905 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Hcn1
Gene Name hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Synonym(s) HAC2, Bcng1, C630013B14Rik
Chromosomal Location 117,602,320-117,987,418 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010408; MGI:1096392

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: K340*

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Blood Pressure: HR Average - decreased 24218458
Blood Pressure: HR Day 2 - decreased 24218458
Blood Pressure: HR Day 3 - decreased 24218458
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2018-11-16 12:07 PM by Anne Murray
Record Created 2017-02-24 2:09 PM
Record Posted 2018-11-16
Phenotypic Description

Figure 1. Thump mice exhibited a reduction in heart rate at day 2 of testing. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Thump mice exhibited a reduction in heart rate at day 3 of testing. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Thump mice exhibited a reduction in average heart rates. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Thump phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5144, some of which showed a reduction in heart rate at days 2 (Figure 1) and 3 (Figure 2) of testing as well as an overall reduced average heart rate (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the average heart rate phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R5144. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Hcn1: an A to T transversion at base pair 117,873,905 (v38) on chromosome 13, or base pair 271,586 in the GenBank genomic region NC_000079 encoding Hcn1. The strongest association was found with an additive model of inheritance to the reduced average heart rate phenotype, wherein five homozygous variant mice and 30 heterozygous mice departed phenotypically from 20 homozygous reference mice with a P value of 7.482 x 10-9 (Figure 4).  

 

The mutation corresponds to residue 1,402 in the mRNA sequence NM_010408 within exon 4 of 8 total exons.

 

1387 TCCTACGCACTCTTCAAAGCTATGAGTCACATG
335  -S--Y--A--L--F--K--A--M--S--H--M-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of lysine 340 for a premature stop codon (K340*) in the HCN1 protein.

Protein Prediction
Figure 5. HCN1 structure. A, Domain organization. B, Topography. C, Crystal structure of human HCN1. UCSF Chimera model is based on PDB 5U6O. The cyclic nucleotide-binding domain (CNBD) is in an unsolved portion of the protein. The location of the Thump mutation is indicated. The C-linker consists of six α-helices: A' to F', and the CNBD domain consists of α-helices A, B, and C. Domain and topology information is from SMART and UniProt.

Figure 6. Structure of human HCN1 homotetramer. Protein is colored as in Figure 5. The inset shows the top view of the channel. UCSF Chimera model is based on PDB 5U6O, Lee and MacKinnon. Cell. 168, 111-120.e11 (2017). Click on the 3D structure to view it rotate.

Hcn1 encodes hyperpolarization-activated cyclic nucleotide-gated (HCN) channel 1 (HCN1). The HCN channels (i.e., HCN1, HCN2 (see the record for curveball), HCN3, and HCN4) are members of the voltage-gated potassium ion channel superfamily that are primarily expressed in neurons and heart cells (1). The HCN proteins share 80 to 90 percent sequence identity between transmembrane domain one and the end of the cyclic nucleotide-binding domain (CNBD) (Figure 5). Most differences between the HCN proteins are at the N- and C-termini. The HCN channels form complexes of four HCN subunits (homo- and heterotetramers) arranged around a central pore (Figure 6) (2-5).

 

HCN1 has an HCN domain, six transmembrane domains (S1 through S6), a charged voltage sensor in S4, a pore-lining P loop between S5 and S6, a C-linker, a C-terminal CNBD, and a PDZ-binding domain [Figures 5 and 6; PDB:5U6P; (5;6)]. The 45 to 50 amino acids preceding S1 form a three α-helical domain (termed the HCN domain) that is wedged between the voltage sensor and the cytoplasmic domains. The HCN domain contacts the S4 helix (near the short S4–S5 linker) from the same subunit as well as the C-linker and CNBD from an adjacent subunit. The HCN domain is putatively involved in intersubunit interactions and in the formation of functional channels (7). S6 forms a right-handed, tightly packed bundle within the membrane’s inner leaflet (5). At the level of the intracellular membrane-water interface the S6 helix makes a sharp bend and transitioning to a helix-turn-helix. The pore region contains a GYG motif, which is an ion selectivity filter (8). The HCN1 gate is closed by a tightly packed inner helical bundle that constricts the pore to a radius of about 1 Å at amino acid positions Val390, Thr394, and Gln398. The C-linker domain forms an α-helical disk just below the membrane and connects the CNBD to the transmembrane domains. The CNBD is comprised of five short α-helices and a β-jelly roll and is docked onto the cytoplasmic face of the C-linker disk (5;9). The CNBD mediates modulation by cyclic nucleotides (10).

 

The C-linker and CNBD together are referred to as the cAMP-sensing domain. Cyclic adenosine monophosphate (cAMP) is the physiological agonist of HCN1 (11;12). cAMP shifts the voltage activation range of HCN1 in the positive direction (11;13;14). Binding of cyclic nucleotides to the CNBD of HCN1 results in conformational changes that stabilize its open state (10;11;14). The cyclic nucleotides bind HCN1 between the β-roll and the C-helix (12). Upon cAMP binding, the C-helix moves in toward the β-roll (9;15;16).

 

HCN1, 2, and 4 have a PDZ-binding domain in the C-terminal tail that mediates interactions with PDZ-containing proteins and the chaperone TRIP8b (17-20). Association with TRIP8b regulates HCN1 trafficking and inhibits gating through interaction with HCN1 at two C-terminal sites: the PDZ-binding domain and the C-linker-CNBD region (20). The C-linker-CNBD/TRIP8b interaction is necessary and sufficient to enable TRIP8b to downregulate channel surface expression and inhibit channel gating. The PDZ-binding domain/TRIP8b interaction stabilizes the C-terminal domain of TRIP8b, allowing for optimal interaction between HCN1 and TRIP8b. HCN1 interacts with filamin A via a 22-amino acid sequence downstream of the CNBD (21;22). Filamin A is an actin-binding scaffold protein that links HCN1 to the actin cytoskeleton. Filamin A putatively causes clustering and slows down the activation and deactivation kinetics of HCN1 (21;23).

 

Protein kinase A phosphorylation of the HCN channels stimulates HCN current after β-adrenergic receptor stimulation in early cardiomyogenesis (24). Protein kinase C (PKC)-mediated phosphorylation of the HCN channels results in reduced HCN current and HCN1 surface expression in hippocampal neurons (25). Src tyrosine kinases phosphorylate HCN1, HCN2, and HCN4 in mature cardiac cells and neurons, stimulating HCN function (26-28). Calcium/calmodulin-dependent protein kinase II (29) and p38 mitogen-activated protein kinase (30) phosphorylate the HCN channels in neuronal cells.

 

The Thump mutation results in substitution of lysine 340 for a premature stop codon (K340*); Lys340 is within the pore-forming P loop.

Expression/Localization

The HCN channels are widely expressed in peripheral and central nervous system neurons and cardiac tissues [reviewed in (31)]. More specifically, HCN1 is expressed in the olfactory bulb, cerebral cortex, hippocampus, superior colliculus, spinal cord, dorsal root ganglion, and cerebellum of the mouse (32;33). In neurons, HCN1 is predominantly expressed in distal dendrites. In the heart, HCN1 is highly expressed in the sinoatrial node. HCN1 is also expressed in photoreceptor inner segments (34;35) and cochlear hair cells (22).

Background
Figure 7. HCN1 channel. Each subunit of the HCN1 channel forms 6 transmembrane segments (S1–S6). S4 is a positively charged voltage sensor. The pore region is between S5 and S6. (Two subunits of the channel are shown for clarity.) CNBD in the cytoplasm and mediates modulation through cAMP. The HCN channels allow Na+ and K+ to enter, creating an Ih current in the brain and an If  current in the heart).
Figure 8. The phototransduction cycle in rod cells. In the dark, opsin is bound to 11-cis-retinal to form inactive rhodopsin (R) in the disc membranes. Basal activity of the guanylyl cyclase (GC) keeps cGMP levels high. The binding of Ca2+-bound calmodulin (CaM) confers high affinity for cGMP to cGMP-gated channels in the plasma membrane, allowing these channels to remain open. Both Na+ and Ca2+enter the channels resulting in high Ca2+ levels and Ca2+-bound guanylate cyclase-activating protein (GCAP). Light (hv) results in photoisomerization of 11-cis-retinal to all-trans-retinal, forming activated rhodopsin (R*), which binds and activates the heterotrimeric G protein, transducin (αβγ). The GTP-bound transducin α subunit activates cGMP phosphodiesterase (PDE), which hydrolyzes cGMP to GMP, reducing the cGMP concentration and the binding of cGMP to the cGMP-gated channels. The probability of channel closing increases proportional to light intensity, reducing Ca2+ influx. Intracellular Ca2+ is further depleted by activity of the Na+-Ca2+, K+exchanger. Low intracellular Ca2+ leads to active GCAP, which in turn activates GC to synthesize cGMP from GTP supplied by the guanine nucleotide cycle. This comprises guanylate kinase (GK) and nucleoside diphosphate kinase (NDPK). Release of Ca2+ from CaM leads to its dissociation from the cGMP-gated channels conferring a lower affinity from cGMP and further closure of the channels. This image is interactive. Other mutations found in the pathway are noted in red. Click on each mutation for more information.HCNs promote synaptic integration, neuronal excitability, and the formation of resting membrane potentials in the central and peripheral nervous systems as well as cardiac nodal cell pacemaker activity (6;36). The HCN channels generate inward current (Ih in the brain and If/Iq in the heart) (Figure 7). Ih is a Na+/K+ current when the membrane potential is hyperpolarized, producing rhythmic electrical activity in neurons and in cardiac sinoatrial node (SAN) cells; see the “Putative Mechanism” section for more information about HCN1 function in SAN cells. In neurons, the Ih currents regulate the determination of resting membrane potential, action potential firing rate, dendritic integration, and synaptic transmission (37).

HCNs promote synaptic integration, neuronal excitability, and the formation of resting membrane potentials in the central and peripheral nervous systems as well as cardiac nodal cell pacemaker activity (6;36). The HCN channels generate inward current (Ih in the brain and If/Iq in the heart) (Figure 7). Ih is a Na+/K+ current when the membrane potential is hyperpolarized, producing rhythmic electrical activity in neurons and in cardiac sinoatrial node (SAN) cells; see the “Putative Mechanism” section for more information about HCN1 function in SAN cells. In neurons, the Ih currents regulate the determination of resting membrane potential, action potential firing rate, dendritic integration, and synaptic transmission (37).

 

Retina photoreceptor cells are specialized neurons that absorb photons from the field of view and signal this information through a change in membrane potential. Both rod and cone cells have the same basic structure with an axon terminal located closest to the visual field, an organelle containing cell body, followed by a mitochondrial-rich inner segment and finally the outer segment, which contains the light-absorbing materials. The chief function of the inner segment is to provide ATP for the sodium-potassium pump that maintains the cell membrane potential. The outer segments are modified cilia that contain disks filled with opsin (see the record bemr3 for information about rhodopsin), as well as voltage-gated sodium channels. Rod cells differ from cone cells not only in the type of opsin they contain, but also in the amount of opsin as the sensitivity of rod cells to light is provided in part by the large amounts of rhodopsin they contain in their outer segments. Visual phototransduction is a process by which light is converted into electrical signals in the rod cells, cone cells and photosensitive ganglion cells in the retina. This process is initiated by the absorption of photons and isomerization of 11-cis-retinal into all-trans-retinal, resulting in rhodopsin activation (Figure 8). The first step of the phototransduction cascade is the transitory binding of photoactivated rhodopsin (Rho*) and transducin, a heterotrimeric G protein that alternates between an inactive guanosine diphosphate (GDP) and an active guanosine triphosphate (GTP) bound state. The GDP form of transducin docks onto the Rho* surface, and GDP then dissociates from the complex allowing GTP to bind to transducin. GTP-bound transducin then dissociates from Rho*, interacts with the γ subunits of the cyclic GMP (cGMP) phosphodiesterase PDE6, which activates the catalytic α or β subunits and results in hydrolysis of cGMP. Depletion of cGMP in the ROS results in closure of cGMP-gated channels in the plasma membrane and hyperpolarization of the photoreceptor cell, which prevents the release of neurotransmitters. HCN1 shapes and shortens photoreceptor voltage responses (38;39). Hyperpolarization of the plasma membrane after closure of the CNG channels in the outer segment induces opening of HCN1. An inward current through the open HCN1 channels reduces the level of the hyperpolarization. Loss of HCN1 expression results in sustained high rod signals for a prolonged period of time (40). Hcn1-/- mice showed exaggerated, prolonged rod photoreceptor responses as determined by electroretinography as well as a reduced flicker (train of flashes) fusion frequency (35;40).

 

Mutations in HCN1 are associated with early infantile epileptic encephalopathy-24 (EIEE24; OMIM: #615871) (41;42). Patients with EIEE24 exhibit pharmacoresistant febrile seizures between 4 and 13 months of age as well as intellectual disability of varying degrees, behavioral disturbances, autistic features, and ataxia (42).

 

Hcn1-deficient (Hcn1-/-) mice are overtly healthy, but exhibit learned motor skill deficits in a rotarod test and increased thigmotaxis (i.e., remain close to walls) in a water maze test (43). Hcn1-/- mice showed susceptibility to limbic seizure induction by amygdala kindling, kainic acid, or pilocarpine administration whereby the mice showed higher seizure severity and higher seizure-related mortality than wild-type mice (44;45). Hcn1-/- mice also showed reduced cold allodynia after partial sciatic nerve ligation (46). Hcn1-/- mice also showed less sensitive auditory brainstem responses as well as lower baseline acoustic startle responses (47). Mice with conditional Hcn1 knockout in the forebrain exhibited increased hippocampal-dependent learning and memory as well as enhanced long-term potentiation at the direct perforant path input to the distal dendrites of CA1 pyramidal neurons (48). Cerebellar Purkinje cell-specific HCN1 knockout mice showed defects in late stages of motor learning (49).

Putative Mechanism

The heartbeat is initiated and maintained by the generation of spontaneous action potentials in the pacemaker cells of the SAN region in the right atrial endocardium. Several ion channels (calcium, potassium, and sodium) function in the maintenance of the SAN action potential. Among those, HCN channels are involved in the hyperpolarization-activated current. Three member of the HCN family have been identified in pacemaker cells: HCN1, 2 and 4. HCN4 is responsible for 70% of hyperpolarization-activated current (50). The If controls heart rate, and is activated by a membrane potential more negative than -50 mV (Figure 7). Several factors can increase the If, including catecholamines, adrenaline, and noradrenaline. Blockage of the If current reduces the heart rate by up to 20 to 30 percent. Hcn1-/- mice have reduced beating frequency in isolated pacemaker cells, in intact SAN, and in the whole heart as well as reduced cardiac output (69% of wild-type) (50). The heart rate phenotype of the Thump mice indicates loss of HCN1-related function in the heart. Overt neurological phenotypes were not observed, and retinal function was not assessed in the Thump mice.

Primers PCR Primer
Thump(F):5'- CTAGGCTCACATGAACAAAAGG -3'
Thump(R):5'- ACTGCCTCCTTGAAGAGTCC -3'

Sequencing Primer
Thump_seq(F):5'- GCATTTGGTTAGCATCCAGTTAGAAG -3'
Thump_seq(R):5'- TGCCTCCTTGAAGAGTCCAAAGAC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsSamantha Teixeira and Bruce Beutler
List |< first << previous [record 9 of 132] next >> last >|