Phenotypic Mutation 'Jialin'

• Allele: Jialin
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 102,695,715 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Cd44
• Gene Name: CD44 antigen
• Synonym(s): Pgp-1, Ly-24, HERMES
• Chromosomal Location: 102,641,486-102,732,010 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation. [provided by MGI curators]
• Mapped: Yes
• Limits of the Critical Region: 102811141 - 102901625 bp
• Amino Acid Change: Glutamic Acid changed to Aspartic acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005218] [ENSMUSP00000062330] [ENSMUSP00000097265] [ENSMUSP00000106821] [ENSMUSP00000106822] [ENSMUSP00000106823] [ENSMUSP00000106825] [ENSMUSP00000106829]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000005218; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	251	276	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	640	653	N/A	INTRINSIC
low complexity region	689	703	N/A	INTRINSIC
PDB:2ZPY|B	710	729	1e-6	PDB

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
  (Using ENSMUST00000005218)
• SMART Domains: Protein: ENSMUSP00000062330; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	229	239	N/A	INTRINSIC
low complexity region	440	453	N/A	INTRINSIC
low complexity region	489	503	N/A	INTRINSIC
PDB:2ZPY|B	510	529	1e-6	PDB

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
  (Using ENSMUST00000060516)
• SMART Domains: Protein: ENSMUSP00000097265; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	225	238	N/A	INTRINSIC
low complexity region	274	288	N/A	INTRINSIC
PDB:2ZPY|B	295	314	1e-6	PDB

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
  (Using ENSMUST00000099673)
• SMART Domains: Protein: ENSMUSP00000106821; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	324	337	N/A	INTRINSIC
low complexity region	373	387	N/A	INTRINSIC
PDB:2ZPY|B	394	413	8e-7	PDB

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
  (Using ENSMUST00000111190)
• SMART Domains: Protein: ENSMUSP00000106822; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	358	371	N/A	INTRINSIC
low complexity region	407	421	N/A	INTRINSIC
PDB:2ZPY|B	428	447	9e-7	PDB

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000111191)
• SMART Domains: Protein: ENSMUSP00000106823; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	294	307	N/A	INTRINSIC
low complexity region	343	357	N/A	INTRINSIC
PDB:2ZPY|B	364	383	1e-6	PDB

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
  (Using ENSMUST00000111192)
• SMART Domains: Protein: ENSMUSP00000106825; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	268	278	N/A	INTRINSIC
low complexity region	302	312	N/A	INTRINSIC
low complexity region	437	450	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC
PDB:2ZPY|B	507	526	1e-6	PDB

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
  (Using ENSMUST00000111194)
• SMART Domains: Protein: ENSMUSP00000106829; Gene: ENSMUSG00000005087; AA Change: E52D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LINK	34	125	5.88e-38	SMART
low complexity region	306	316	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	566	580	N/A	INTRINSIC
PDB:2ZPY|B	587	606	1e-6	PDB

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
  (Using ENSMUST00000111198)
• Meta Mutation Damage Score: 0.8609
• Is this an essential gene?: Probably nonessential (E-score: 0.200)
• Phenotypic Category: Autosomal Dominant
• Mode of Inheritance: Autosomal Dominant
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:40 PM by Anne Murray
• Record Created: 2017-03-12 12:12 PM by Xue Zhong
• Record Posted: 2018-09-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Aijie Liu, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009851 (variant 1), NM_001039150 (variant 2), NM_001039151 (variant 3), NM_001177785 (variant 4), NM_001177786 (variant 5), NM_001177787 (variant 6); MGI:88338

Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced(other)(1) Radiation induced(1) Targeted(13) Transgenic(1)

Phenotypic Description

Figure 1. Jialin mice exhibit decreased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Jialin mice exhibit decreased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Jialin mice exhibit decreased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Jialin mice exhibit decreased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Jialin mice exhibit decreased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Jialin mice exhibit decreased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Jialin mice exhibit reduced expression of CD44 on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Jialin mice exhibit reduced expression of CD44 on CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Jialin mice exhibit reduced expression of CD44 on CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Jialin phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5118, some of which showed reduced frequencies of CD44+ T cells (Figure 1), CD44+ CD4 T cells (Figure 2), CD44+ CD8 T cells (Figure 3), central memory CD4 T cells in CD4 T cells (Figure 4), effector memory CD4 T cells in CD4 T cells (Figure 5), and central memory CD8 T cells in CD8 T cells (Figure 6). Some mice showed reduced expression of CD44 on T cells (Figure 7), CD4 T cells (Figure 8), and CD8 T cells (Figure 9), all in the peripheral blood.

Nature of Mutation

Figure 10. Linkage mapping of the reduced frequency of CD44+ CD8 T cells using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 52 mutations (X-axis) identified in the G1 male of pedigree R5118. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations. All of the above anomalies were linked to a mutation in Cd44: a G to T transversion at base pair 102,865,370 (v38) on chromosome 2, or base pair 36,300 in the GenBank genomic region NC_000068 encoding Cd44. The strongest association was found with a dominant model of inheritance to the reduced frequency of CD44+ CD8 T cells, wherein seven variant homozygotes and 44 heterozygous mice departed phenotypically from 24 homozygous reference mice with a P value of 2.515 x 10^-16 (Figure 10).  

The mutation corresponds to residue 475 in the mRNA sequence NM_009851 within exon 2 of 19 total exons.

458 AGTATCTCCCGGACTGAGGCAGCTGACCTCTGC 47  -S--I--S--R--T--E--A--A--D--L--C-

The mutated nucleotide is indicated in red.  The mutation results in a glutamic acid (E) to aspartic acid (D) substitution at position 52 (E52D) in the CD44 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.649).

Protein Prediction

Figure 11. Domain organization of CD44. The Jialin mutation results in a glutamic acid to aspartic acid substitution at position 52 in the CD44 protein. Abbreviations: SP, signal peptide; TM, transmembrane domain. The topology is indicated by brackets above the domain.

The Cd44 gene encodes CD44 (alternatively, Pgp-1 [P-glycoprotein 1]), a type I membrane glycoprotein and member of the cell adhesion molecule superfamily (Figure 11).

The N-terminal extracellular domain of CD44 mediates interactions with the external microenvironment and senses stimuli. The extracellular domain contains a hyaluronic acid (HA)-binding “link” domain at residues 34 to 123. HA is a glycosaminoglycan and component of the extracellular matrix. CD44 has chondroitin- and heparin-like glycosaminoglycan binding sites that recognize the α5 chain of laminin (1). The CD44 chondroitin sulfate binding site also binds type IV collagen [see the record for aoba] (2) and fibronectin (3). A stem structure separates the N-terminal globular domain from the plasma membrane and contains putative proteolytic cleavage sites (4).

The transmembrane domain of CD44 mediates interactions with cofactors and adaptor proteins, directs lymphocyte homing, and putatively mediates CD44 association with lipid rafts (5;6).

The CD44 intracellular tail binds with cytoskeletal elements (e.g., ankyrin, ERM [ezrin/radixin/moesin], and Merlin), signaling molecules (e.g., Src, Lck [see the record for iconoclast], Fyn, and Lyn [see the record for Lemon]), and activators of small Rho GTPases [reviewed in (7)]. The CD44 intracellular domain can be sequentially proteolytically cleaved by MT1-MMP (membrane type 1 matrix metalloprotease) and presenilin-1/γ (see the record for hiortron). The cleaved peptide (CD44-ICD) translocates to the nucleus to activate the transcription of several genes (8). CD44 cleavage also allows the release of cells bound to HA. Protein kinase C-mediated CD44 phosphorylation at Ser291 and Ca²⁺/calmodulin-dependent protein kinase II-mediated CD44 phosphorylation at Ser325 increases ERM binding to CD44 (9). Ankyrin binding is also phosphorylation-dependent.

Cd44 encodes multiple isoforms due to insertion of alternative exons (exons 6 [variant 1; v1] to 15 [variant 10; v10]) (10). The isoforms differ within the extracellular domain. Exons 1 through 5, exon 17 (encoding the transmembrane domain), and exons 18 and 19 (encoding the intracellular domain) are consistent among all of the isoforms (11).

The Jialin mutation results in a glutamic acid (E) to aspartic acid (D) substitution at position 52 (E52D); Glu52 is within the link domain.

Expression/Localization

Canonical CD44 is ubiquitously expressed. CD44 variants are expressed on a selection of epithelial cells, keratinocytes, and macrophages (12). CD44v5 is expressed on activated T cells, CD44v6 is expressed in proliferative tissues (e.g., skin and crypts of the intestine), CD44v4-7 is expressed in rat pancreatic carcinoma, CD44v4-10 is expressed on Igr5+ intestinal stem cells, CD44v6-10 and CD44v8-10  are expressed on some epithelial cells, and CD44v1-10, CD44v2-10, and CD44v3-10 are expressed on keratinocytes [reviewed in (7;13)].

Background

Figure 12. CD44 is a multifunctional receptor. The CD44 extracellular domain can bind various ligands, including hyaluronan (HA), extracellular matrix (ECM) glycoproteins and proteoglycans, growth factors, cytokines and matrix metalloproteinases. CD44 can be sequentially cleaved by membrane type 1 matrix metalloprotease (MT1-MMP) and then presenilin-1/γ secretase . Cleavage produces an extracellular domain (ECD) fragment, a transmembrane domain (TM), and a CD44 intracellular domain (ICD) fragment. CD44—ICD translocates into the nucleus to activate transcription of genes important in metastasis, cell survival, invasion, migration, and angiogenesis. The cytoplasmic domain is also responsible for signal transduction through binding to different molecules, including cytoskeleton components, kinases and activators of small Rho GTPases. CD44 can promote signaling by acting as a coreceptor to oncogenes such as c-Met and ErbB receptors. These interactions promote activation of signaling pathways that promote growth and cellular invasion. The CD44-phosphorylated ERM complex initiates activation of transforming growth factor-β receptor 1 and 2 (TGFβRI and II) and the downstream SMAD signaling complex, which contribute to fibrosis.

CD44 is a receptor that functions in HA metabolism, hematopoiesis, limb development, wound healing, inflammation, matrix adhesion, lymphocyte activation, cytokine and growth factor release, lymph node homing, cancer cell metastasis, and angiogenesis (14).

CD44 is the main cell surface receptor for HA (Figure 12) (14). HA binding to CD44 is required for the homing of leukemic cells in the bone marrow, neutrophil and monocyte/macrophage recruitment to sites of inflammation, quiescence and stemness regulation of acute myeloid leukemia cells, and chronic lymphocytic leukemia cell proliferation [(15-18); reviewed in (19)]. CD44 binding to HA also promotes the uptake and degradation of HA (20). 

CD44 also binds other ligands, including osteopontin (OPN) (21), laminin (1), collagen (2), fibronectin (3), growth factors, cytokines, and matrix metalloproteinases (MMPs) [reviewed in (7;22)]. OPN-CD44 signaling promotes prostate cancer growth and progression (23) as well as cell migration out of the bloodstream to sites of inflammation (24). MMP9-CD44 association promotes MMP9 localization on the cell surface in tumor cells (25). Interaction between CD44 and a proteolytic form of MMP9 promotes the invasion of prostate cancer cells by causing the degradation of collagen IV, growth factor activation, survival mechanisms, latent TGFβ activation, and angiogenesis.

CD44 functions as a co-receptor for receptor tyrosine kinases (e.g., HGFR, MST1R, EGFR [see the record for Velvet], PDGFR, FGFR [see the record for Modest], and VEGFR [see the record for flywheels]) (13), CXCR4 (26), and LRP6 (27). HA binding to CD44 increases CXCR4-associated signaling to promote angiogenesis (26). CD44v6 promotes signaling downstream of receptor tyrosine kinases by driving receptor activation and by recruiting ERM proteins and the cytoskeleton to promote receptor signaling (13;28;29). LRP6 recruitment of CD44 promotes β-catenin activation and translocation to the nucleus (27).

Expression of the alternative CD44 isoforms has been detected in several human pathologies, including pancreatic cancer (CD44v8-10) (30), cervical cancer (CD44v6), colorectal cancer (CD44v6) (31), and head and neck squamous carcinoma (32;33). Expression of the alternative isoforms correlates with poor prognosis and metastatic potential (34-37). Expression of CD44v5, CD44v6, and CD44v10 have been detected in the synovial fluid and serum in patients with rheumatoid arthritis (38;39). CD44v6 and CD44v7 expression are associated with colonic inflammation and increased severity of inflammatory bowel disease (40-42).

CD44-deficient (Cd44^-/-) mice exhibited impaired T lymphocyte trafficking resulting in muted inflammatory responses, altered myeloid progenitor distribution, reduced growth of tumors, and impaired uterine involution and maintenance of lactation (43-47). The Cd44^-/- mice exhibited reduced mast cell numbers and histamine content in the peritoneal cavities and ear tissues (48) as well as thinning of the epidermis and delayed early barrier recovery after acute barrier disruption (49). Mice deficient in CD44v7 exhibited reduced susceptibility to experimental autoimmune encephalomyelitis (50), but exhibited persistent inflammation after exposure to trinitrobenzene sulfonic acid (experimental model of colitis) (51). The CD44v7 null mice also exhibited downregulation of Th1-type cytokines with concomitant upregulation of Th2 cytokines (51).

Putative Mechanism

The phenotypes observed in the Jialin mice indicate loss of CD44^Jialin function in hematopoiesis and T lymphocyte trafficking.

Primers

PCR Primer
Jialin_pcr_F: CTTATTCAACTGTCAGGGAGGAG
Jialin_pcr_R: GCATGTTTGGCTTCTCCCAATG

Sequencing Primer
Jialin_seq_F: GAGGAGCCTTCCAGCCATAAG
Jialin_seq_R: CCCAATGCCCCATCTGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 2, - strand):

1   gcatgtttgg cttctcccaa tgccccatct ggcgtggttt tttttttttt tttttttaag
61  tcttcactta caagcacttc ttaccattga tctagtttca tgcaaattat taatgcaaaa
121 gcctctaaca tctccgtttc ctcccacaga tttgaatgta acctgccgct acgcaggtgt
181 attccatgtg gagaaaaatg gccgctacag tatctcccgg actgaggcag ctgacctctg
241 ccaggctttc aacagtacct tacccaccat ggaccaaatg aagttggccc tgagcaaggg
301 ttttgaaaca tgcaggtaag agagcagcac cttcactggg aaaagcccac tggttggggc
361 ggcgcttatg gctggaaggc tcctccctga cagttgaata ag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Ishii, S., Ford, R., Thomas, P., Nachman, A., Steele, G.,Jr, and Jessup, J. M. (1993) CD44 Participates in the Adhesion of Human Colorectal Carcinoma Cells to Laminin and Type IV Collagen. Surg Oncol. 2, 255-264.

  2. Lauer-Fields, J. L., Malkar, N. B., Richet, G., Drauz, K., and Fields, G. B. (2003) Melanoma Cell CD44 Interaction with the Alpha 1(IV)1263-1277 Region from Basement Membrane Collagen is Modulated by Ligand Glycosylation. J Biol Chem. 278, 14321-14330.

  3. Jalkanen, S., and Jalkanen, M. (1992) Lymphocyte CD44 Binds the COOH-Terminal Heparin-Binding Domain of Fibronectin. J Cell Biol. 116, 817-825.

  4. Okamoto, I., Kawano, Y., Tsuiki, H., Sasaki, J., Nakao, M., Matsumoto, M., Suga, M., Ando, M., Nakajima, M., and Saya, H. (1999) CD44 Cleavage Induced by a Membrane-Associated Metalloprotease Plays a Critical Role in Tumor Cell Migration. Oncogene. 18, 1435-1446.

  5. Perschl, A., Lesley, J., English, N., Hyman, R., and Trowbridge, I. S. (1995) Transmembrane Domain of CD44 is Required for its Detergent Insolubility in Fibroblasts. J Cell Sci. 108 ( Pt 3), 1033-1041.

  6. Underhill, C. (1992) CD44: The Hyaluronan Receptor. J Cell Sci. 103 ( Pt 2), 293-298.

  7. Ponta, H., Sherman, L., and Herrlich, P. A. (2003) CD44: From Adhesion Molecules to Signalling Regulators. Nat Rev Mol Cell Biol. 4, 33-45.

  8. Okamoto, I., Kawano, Y., Murakami, D., Sasayama, T., Araki, N., Miki, T., Wong, A. J., and Saya, H. (2001) Proteolytic Release of CD44 Intracellular Domain and its Role in the CD44 Signaling Pathway. J Cell Biol. 155, 755-762.

  9. Legg, J. W., Lewis, C. A., Parsons, M., Ng, T., and Isacke, C. M. (2002) A Novel PKC-Regulated Mechanism Controls CD44 Ezrin Association and Directional Cell Motility. Nat Cell Biol. 4, 399-407.

  10. Cichy, J., and Pure, E. (2003) The Liberation of CD44. J Cell Biol. 161, 839-843.

  11. Screaton, G. R., Bell, M. V., Jackson, D. G., Cornelis, F. B., Gerth, U., and Bell, J. I. (1992) Genomic Structure of DNA Encoding the Lymphocyte Homing Receptor CD44 Reveals at Least 12 Alternatively Spliced Exons. Proc Natl Acad Sci U S A. 89, 12160-12164.

  12. Sneath, R. J., and Mangham, D. C. (1998) The Normal Structure and Function of CD44 and its Role in Neoplasia. Mol Pathol. 51, 191-200.

  13. Orian-Rousseau, V., and Sleeman, J. (2014) CD44 is a Multidomain Signaling Platform that Integrates Extracellular Matrix Cues with Growth Factor and Cytokine Signals. Adv Cancer Res. 123, 231-254.

  14. Aruffo, A., Stamenkovic, I., Melnick, M., Underhill, C. B., and Seed, B. (1990) CD44 is the Principal Cell Surface Receptor for Hyaluronate. Cell. 61, 1303-1313.

  15. Zoller, M. (2015) CD44, Hyaluronan, the Hematopoietic Stem Cell, and Leukemia-Initiating Cells. Front Immunol. 6, 235.

  16. Cuff, C. A., Kothapalli, D., Azonobi, I., Chun, S., Zhang, Y., Belkin, R., Yeh, C., Secreto, A., Assoian, R. K., Rader, D. J., and Pure, E. (2001) The Adhesion Receptor CD44 Promotes Atherosclerosis by Mediating Inflammatory Cell Recruitment and Vascular Cell Activation. J Clin Invest. 108, 1031-1040.

  17. McDonald, B., McAvoy, E. F., Lam, F., Gill, V., de la Motte, C., Savani, R. C., and Kubes, P. (2008) Interaction of CD44 and Hyaluronan is the Dominant Mechanism for Neutrophil Sequestration in Inflamed Liver Sinusoids. J Exp Med. 205, 915-927.

  18. Bourguignon, L. Y., Shiina, M., and Li, J. J. (2014) Hyaluronan-CD44 Interaction Promotes Oncogenic Signaling, microRNA Functions, Chemoresistance, and Radiation Resistance in Cancer Stem Cells Leading to Tumor Progression. Adv Cancer Res. 123, 255-275.

  19. Morath, I., Hartmann, T. N., and Orian-Rousseau, V. (2016) CD44: More than a Mere Stem Cell Marker. Int J Biochem Cell Biol. 81, 166-173.

  20. Culty, M., Nguyen, H. A., and Underhill, C. B. (1992) The Hyaluronan Receptor (CD44) Participates in the Uptake and Degradation of Hyaluronan. J Cell Biol. 116, 1055-1062.

  21. Weber, G. F., Ashkar, S., Glimcher, M. J., and Cantor, H. (1996) Receptor-Ligand Interaction between CD44 and Osteopontin (Eta-1). Science. 271, 509-512.

  22. Goodison, S., Urquidi, V., and Tarin, D. (1999) CD44 Cell Adhesion Molecules. Mol Pathol. 52, 189-196.

  23. Katagiri, Y. U., Sleeman, J., Fujii, H., Herrlich, P., Hotta, H., Tanaka, K., Chikuma, S., Yagita, H., Okumura, K., Murakami, M., Saiki, I., Chambers, A. F., and Uede, T. (1999) CD44 Variants but Not CD44s Cooperate with beta1-Containing Integrins to Permit Cells to Bind to Osteopontin Independently of Arginine-Glycine-Aspartic Acid, Thereby Stimulating Cell Motility and Chemotaxis. Cancer Res. 59, 219-226.

  24. Thalmann, G. N., Sikes, R. A., Devoll, R. E., Kiefer, J. A., Markwalder, R., Klima, I., Farach-Carson, C. M., Studer, U. E., and Chung, L. W. (1999) Osteopontin: Possible Role in Prostate Cancer Progression. Clin Cancer Res. 5, 2271-2277.

  25. Yu, Q., and Stamenkovic, I. (1999) Localization of Matrix Metalloproteinase 9 to the Cell Surface Provides a Mechanism for CD44-Mediated Tumor Invasion. Genes Dev. 13, 35-48.

  26. Fuchs, K., Hippe, A., Schmaus, A., Homey, B., Sleeman, J. P., and Orian-Rousseau, V. (2013) Opposing Effects of High- and Low-Molecular Weight Hyaluronan on CXCL12-Induced CXCR4 Signaling Depend on CD44. Cell Death Dis. 4, e819.

  27. Schmitt, M., Metzger, M., Gradl, D., Davidson, G., and Orian-Rousseau, V. (2015) CD44 Functions in Wnt Signaling by Regulating LRP6 Localization and Activation. Cell Death Differ. 22, 677-689.

  28. Tremmel, M., Matzke, A., Albrecht, I., Laib, A. M., Olaku, V., Ballmer-Hofer, K., Christofori, G., Heroult, M., Augustin, H. G., Ponta, H., and Orian-Rousseau, V. (2009) A CD44v6 Peptide Reveals a Role of CD44 in VEGFR-2 Signaling and Angiogenesis. Blood. 114, 5236-5244.

  29. Orian-Rousseau, V., Chen, L., Sleeman, J. P., Herrlich, P., and Ponta, H. (2002) CD44 is Required for Two Consecutive Steps in HGF/c-Met Signaling. Genes Dev. 16, 3074-3086.

  30. Rall, C. J., and Rustgi, A. K. (1995) CD44 Isoform Expression in Primary and Metastatic Pancreatic Adenocarcinoma. Cancer Res. 55, 1831-1835.

  31. Yamane, N., Tsujitani, S., Makino, M., Maeta, M., and Kaibara, N. (1999) Soluble CD44 Variant 6 as a Prognostic Indicator in Patients with Colorectal Cancer. Oncology. 56, 232-238.

  32. Franzmann, E. J., Weed, D. T., Civantos, F. J., Goodwin, W. J., and Bourguignon, L. Y. (2001) A Novel CD44 v3 Isoform is Involved in Head and Neck Squamous Cell Carcinoma Progression. Otolaryngol Head Neck Surg. 124, 426-432.

  33. Wang, S. J., Wreesmann, V. B., and Bourguignon, L. Y. (2007) Association of CD44 V3-Containing Isoforms with Tumor Cell Growth, Migration, Matrix Metalloproteinase Expression, and Lymph Node Metastasis in Head and Neck Cancer. Head Neck. 29, 550-558.

  34. Hofmann, M., Rudy, W., Zoller, M., Tolg, C., Ponta, H., Herrlich, P., and Gunthert, U. (1991) CD44 Splice Variants Confer Metastatic Behavior in Rats: Homologous Sequences are Expressed in Human Tumor Cell Lines. Cancer Res. 51, 5292-5297.

  35. Gunthert, U., Hofmann, M., Rudy, W., Reber, S., Zoller, M., Haussmann, I., Matzku, S., Wenzel, A., Ponta, H., and Herrlich, P. (1991) A New Variant of Glycoprotein CD44 Confers Metastatic Potential to Rat Carcinoma Cells. Cell. 65, 13-24.

  36. Wielenga, V. J., Heider, K. H., Offerhaus, G. J., Adolf, G. R., van den Berg, F. M., Ponta, H., Herrlich, P., and Pals, S. T. (1993) Expression of CD44 Variant Proteins in Human Colorectal Cancer is Related to Tumor Progression. Cancer Res. 53, 4754-4756.

  37. Matzke-Ogi, A., Jannasch, K., Shatirishvili, M., Fuchs, B., Chiblak, S., Morton, J., Tawk, B., Lindner, T., Sansom, O., Alves, F., Warth, A., Schwager, C., Mier, W., Kleeff, J., Ponta, H., Abdollahi, A., and Orian-Rousseau, V. (2016) Inhibition of Tumor Growth and Metastasis in Pancreatic Cancer Models by Interference with CD44v6 Signaling. Gastroenterology. 150, 513-25.e10.

  38. Haberhauer, G., and Kittl, E. M. (1998) Soluble CD44 Isoform Variant-5 (sCD44v5): A New Serum Marker in Rheumatoid Arthritis? J Rheumatol. 25, 1442-1444.

  39. Kittl, E. M., Haberhauer, G., Ruckser, R., Selleny, S., Rech-Weichselbraun, I., Hinterberger, W., and Bauer, K. (1997) Serum Levels of Soluble CD44 Variant Isoforms are Elevated in Rheumatoid Arthritis. Rheumatol Int. 16, 181-186.

  40. Wittig, B., Seiter, S., Schmidt, D. S., Zuber, M., Neurath, M., and Zoller, M. (1999) CD44 Variant Isoforms on Blood Leukocytes in Chronic Inflammatory Bowel Disease and Other Systemic Autoimmune Diseases. Lab Invest. 79, 747-759.

  41. Wittig, B. M., Stallmach, A., Zeitz, M., and Gunthert, U. (2002) Functional Involvement of CD44 Variant 7 in Gut Immune Response. Pathobiology. 70, 184-189.

  42. Camacho, F. I., Munoz, C., Sanchez-Verde, L., Saez, A. I., Alcantara, M., and Rodriguez, R. (1999) CD44v6 Expression in Inflammatory Bowel Disease is Associated with Activity Detected by Endoscopy and Pathological Features. Histopathology. 35, 144-149.

  43. Schmits, R., Filmus, J., Gerwin, N., Senaldi, G., Kiefer, F., Kundig, T., Wakeham, A., Shahinian, A., Catzavelos, C., Rak, J., Furlonger, C., Zakarian, A., Simard, J. J., Ohashi, P. S., Paige, C. J., Gutierrez-Ramos, J. C., and Mak, T. W. (1997) CD44 Regulates Hematopoietic Progenitor Distribution, Granuloma Formation, and Tumorigenicity. Blood. 90, 2217-2233.

  44. Protin, U., Schweighoffer, T., Jochum, W., and Hilberg, F. (1999) CD44-Deficient Mice Develop Normally with Changes in Subpopulations and Recirculation of Lymphocyte Subsets. J Immunol. 163, 4917-4923.

  45. Alstergren, P., Zhu, B., Glogauer, M., Mak, T. W., Ellen, R. P., and Sodek, J. (2004) Polarization and Directed Migration of Murine Neutrophils is Dependent on Cell Surface Expression of CD44. Cell Immunol. 231, 146-157.

  46. Yu, W. H., Woessner, J. F.,Jr, McNeish, J. D., and Stamenkovic, I. (2002) CD44 Anchors the Assembly of matrilysin/MMP-7 with Heparin-Binding Epidermal Growth Factor Precursor and ErbB4 and Regulates Female Reproductive Organ Remodeling. Genes Dev. 16, 307-323.

  47. Gonda, A., Gal, I., Szanto, S., Sarraj, B., Glant, T. T., Hunyadi, J., and Mikecz, K. (2005) CD44, but Not l-Selectin, is Critically Involved in Leucocyte Migration into the Skin in a Murine Model of Allergic Dermatitis. Exp Dermatol. 14, 700-708.

  48. Takano, H., Nakazawa, S., Shirata, N., Tamba, S., Furuta, K., Tsuchiya, S., Morimoto, K., Itano, N., Irie, A., Ichikawa, A., Kimata, K., Nakayama, K., Sugimoto, Y., and Tanaka, S. (2009) Involvement of CD44 in Mast Cell Proliferation during Terminal Differentiation. Lab Invest. 89, 446-455.

  49. Bourguignon, L. Y., Ramez, M., Gilad, E., Singleton, P. A., Man, M. Q., Crumrine, D. A., Elias, P. M., and Feingold, K. R. (2006) Hyaluronan-CD44 Interaction Stimulates Keratinocyte Differentiation, Lamellar Body formation/secretion, and Permeability Barrier Homeostasis. J Invest Dermatol. 126, 1356-1365.

  50. Ghazi-Visser, L., Laman, J. D., Nagel, S., van Meurs, M., van Riel, D., Tzankov, A., Frank, S., Adams, H., Wolk, K., Terracciano, L., Melief, M. J., Sabat, R., and Gunthert, U. (2013) CD44 Variant Isoforms Control Experimental Autoimmune Encephalomyelitis by Affecting the Lifespan of the Pathogenic T Cells. FASEB J. 27, 3683-3701.

  51. Wittig, B. M., Johansson, B., Zoller, M., Schwarzler, C., and Gunthert, U. (2000) Abrogation of Experimental Colitis Correlates with Increased Apoptosis in Mice Deficient for CD44 Variant Exon 7 (CD44v7). J Exp Med. 191, 2053-2064.