Phenotypic Mutation 'runt2' (pdf version)
List |< first << previous [record 18 of 132] next >> last >|
Allelerunt2
Mutation Type nonsense
Chromosome1
Coordinate82,286,967 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Irs1
Gene Name insulin receptor substrate 1
Synonym(s) G972R, IRS-1
Chromosomal Location 82,233,101-82,291,416 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010570; MGI:99454

Mapped Yes 
Amino Acid Change Leucine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000063795]
SMART Domains Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: L1176*

DomainStartEndE-ValueType
PH 13 117 8.13e-14 SMART
low complexity region 123 143 N/A INTRINSIC
IRS 155 257 1.19e-35 SMART
PTBI 155 257 7.8e-60 SMART
low complexity region 263 276 N/A INTRINSIC
low complexity region 378 399 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
low complexity region 662 689 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 1019 1040 N/A INTRINSIC
low complexity region 1051 1062 N/A INTRINSIC
low complexity region 1111 1127 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 20032200
Body Weight (DSS Female) - decreased 20032200
Body Weight (DSS Male) - decreased 20032200
Body Weight (DSS) - decreased 20032200
Body Weight (Female) - decreased 20032200
Body Weight (Male) - decreased 20032200
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(1) Chemically induced (other)(1) Radiation induced(1) Spontaneous(2) Targeted(6) Transgenic(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Irs1 APN 1 82288483 missense probably benign 0.01
IGL00534:Irs1 APN 1 82288471 missense probably benign
IGL01926:Irs1 APN 1 82289959 missense probably damaging 0.98
IGL02130:Irs1 APN 1 82289467 missense probably damaging 1.00
IGL03338:Irs1 APN 1 82288401 missense probably benign 0.05
runt UTSW 1 82287732 frame shift probably null
R0019:Irs1 UTSW 1 82287256 nonsense probably null
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0063:Irs1 UTSW 1 82288859 missense probably damaging 1.00
R0318:Irs1 UTSW 1 82288660 missense probably benign 0.01
R1199:Irs1 UTSW 1 82289626 missense probably damaging 1.00
R1363:Irs1 UTSW 1 82287288 missense probably benign 0.02
R1584:Irs1 UTSW 1 82289444 missense probably benign 0.24
R1874:Irs1 UTSW 1 82289853 frame shift probably null
R1903:Irs1 UTSW 1 82289461 missense probably damaging 1.00
R1929:Irs1 UTSW 1 82288459 missense probably benign
R1986:Irs1 UTSW 1 82288765 missense probably damaging 1.00
R2136:Irs1 UTSW 1 82290042 missense probably damaging 1.00
R2179:Irs1 UTSW 1 82290219 missense possibly damaging 0.81
R2271:Irs1 UTSW 1 82288459 missense probably benign
R2760:Irs1 UTSW 1 82288570 missense probably damaging 1.00
R3721:Irs1 UTSW 1 82290085 missense probably benign 0.11
R3821:Irs1 UTSW 1 82290049 missense probably benign
R4306:Irs1 UTSW 1 82287964 missense probably benign 0.11
R4420:Irs1 UTSW 1 82288450 missense possibly damaging 0.94
R4451:Irs1 UTSW 1 82289028 missense probably benign 0.00
R4479:Irs1 UTSW 1 82287294 missense probably damaging 1.00
R4771:Irs1 UTSW 1 82287975 missense probably benign 0.00
R4782:Irs1 UTSW 1 82287463 missense probably benign 0.00
R4836:Irs1 UTSW 1 82287732 frame shift probably null
R4880:Irs1 UTSW 1 82287732 frame shift probably null
R4881:Irs1 UTSW 1 82287732 frame shift probably null
R5031:Irs1 UTSW 1 82286967 nonsense probably null
R5053:Irs1 UTSW 1 82286922 missense probably benign
R5418:Irs1 UTSW 1 82288770 missense probably damaging 1.00
R5595:Irs1 UTSW 1 82289925 missense probably damaging 1.00
R5698:Irs1 UTSW 1 82288734 missense probably benign 0.01
R6381:Irs1 UTSW 1 82287684 missense possibly damaging 0.66
R6563:Irs1 UTSW 1 82288407 missense probably damaging 0.98
X0063:Irs1 UTSW 1 82288908 missense probably damaging 1.00
X0065:Irs1 UTSW 1 82289365 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-10-24 3:26 PM by Anne Murray
Record Created 2017-03-21 4:00 PM
Record Posted 2018-10-24
Phenotypic Description

Figure 1. Runt2 mice exhibited reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The runt2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5031 some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 51 mutations (X-axis) identified in the G1 male of pedigree R5031. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 51 mutations. The body weight phenotype was linked to a mutation in Irs1: a T to A transversion at base pair 82,286,967 (v38) on chromosome 1, or base pair 4,473 in the GenBank genomic region NC_000067 encoding Irs1. Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 17 homozygous reference mice and 18 heterozygous mice with a P value of 7.09 x 10-8 (Figure 2).  

 

The mutation corresponds to residue 4,473 in the mRNA sequence NM_010570 within exon 1 of 2 total exons.

 

4457 TACATAGACCTGGATTTGGCCAAGGAGCGCTCT

1171 -Y--I--D--L--D--L--A--K--E--R--S-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of leucine 1,176 to a premature stop codon (L1176*) in the IRS1 protein.

Protein Prediction
Figure 3. Domain organization of IRS1. The runt2 mutation results in substitution of leucine 1,176 to a premature stop codon. Other mutations found in the IRS protein are noted in red. Click on each mutation for more information.

Irs1 encodes insulin receptor substate-1 (IRS1), one of four members of the IRS family (IRS1 through IRS4). The IRS proteins consist of N-terminal pleckstrin homology (PH) and phosphotyrosine binding (PTB) domains followed by long, unstructured C-terminal tails containing numerous tyrosine, serine, and threonine residues [Figure 3; reviewed in (1)]. IRS1 and IRS2 (see the record for dum_dum) have highly similar PH and PTB domains; the two proteins function analogously in insulin receptor (IR; see the record for gummi_bear) signaling (2). IRS1 and IRS2 differ within their respective tail regions. The PH and PTB domains of IRS1 interact with the activated IR and are therefore necessary for insulin-stimulated tyrosine phosphorylation of IRS1 (3-6). Both domains fold into a seven-stranded, antiparallel β-sandwich capped at one end by an α-helix [PDB:1QQG; (7;8)]. The PTB domain binds to the juxtamembrane region of the IR (8); in vitro binding experiments showed that the IRS1 PTB recognizes an NPXpY sequence motif with a hydrophobic residue at pY−8 (6;9). The IRS1 PH domain binds to phosphatidylinositol phosphates, an interaction that may help bring IRS1 to the IR at the cell membrane (7).

 

IRS1 and IRS2 are regulated by phosphorylation of more than 50 serine/threonine residues within their long, unstructured C-terminal tails (1;10). Depending on the sites affected and the time course of phosphorylation, phosphorylation can have positive or negative regulatory effects on IRS function.

 

The runt2 mutation results in substitution of leucine 1,176 to a premature stop codon (L1176*) in the IRS1 protein; Leu1176 is within the C-terminal tail.

 

Please see the record for runt for more information about Irs1.

Putative Mechanism

The insulin signaling pathway regulates glucose uptake and release as well as the synthesis and storage of carbohydrates and lipids. Binding of insulin to the ectodomain of the IR activates the insulin signaling pathway by triggering a conformational change that facilitates IR autophosphorylation of the kinase domain. Phosphorylation of the kinase activation loop stimulates IR catalytic activity. Phosphorylation of the juxtamembrane region of the IR recruits downstream signaling proteins (e.g., IRS1, IRS2, and Shc [see the record for shrine (Shc2)]). IRS1 and IRS2 do not have intrinsic enzyme activity, but function as docking proteins that bind and activate signal transduction proteins (11). Activated IR propagates signaling to activate three main pathways: the MAP kinase, Cbl/CAP, and PI3K pathways (12). For more information about IR-associated signaling, please the record for gummi_bear.

 

Mutations in IRS1 are associated with noninsulin-dependent diabetes mellitus (OMIM: #125853) (13-15). Degradation of IRS1 contributes to insulin resistance. Prolonged insulin stimulation and subsequent activation of the mTOR signaling pathway promotes IRS degradation by the 26S proteasome (16). A mutation in IRS1 (p.G972R) is a risk factor for coronary artery disease (17). The G972R mutation was also associated with a higher frequency of diabetes mellitus (14.9% among carriers), with a 60% increase of plasma total triglycerides, and with increased total plasma cholesterol levels (17).

 

Systemic knockout of either IRS1 or IRS2 in mice leads to hyperinsulinemia, impaired glucose tolerance, and reduced insulin sensitivity (18-21). However, distinct phenotypes are also observed in Irs1-/- and Irs2-/- mice.  Irs1-/- mice display growth retardation (50 to 60% of WT weight) and their insulin resistance is compensated by β cell hyperplasia so that fasting blood glucose levels are normal in 4-8 week old mice (18;19)Irs1-/- mice also showed higher blood pressures and plasma triglyceride levels with concomitant reduced levels of lipoprotein lipase activity than wild-type mice (22).  In contrast, Irs2-/- mice show mild growth retardation (90% of WT weight) and develop diabetes due to a lack of β cell compensation for insulin resistance (20). Mice expressing a spontaneous Irs1 mutation showed reduced body sizes, hearing loss, less serum IGF1 levels, hyperinsulinemia, mild insulin resistance, low bone mineral densities, reduced trabecular and cortical thicknesses, and low bone formation rates (23).

Primers PCR Primer
runt2(F):5'- ACGCTATTGACGATCCTCTG -3'
runt2(R):5'- GAGACCTTCTCAGCACCTACTC -3'

Sequencing Primer
runt2_seq(F):5'- ATCCTCTGGCTGCTTCTGGAAG -3'
runt2_seq(R):5'- AATACGGTGCCCTTTGGAGC -3'
References
Science Writers Eva Marie Y. Moresco, Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer and Bruce Beutler
List |< first << previous [record 18 of 132] next >> last >|