Phenotypic Mutation 'watermelon'

• Allele: watermelon
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 71,013,531 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Nlrp1a
• Gene Name: NLR family, pyrin domain containing 1A
• Synonym(s): Nalp1
• Chromosomal Location: 70,983,062-71,035,530 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000038186] [ENSMUSP00000104158]
• AlphaFold: Q2LKU9
• SMART Domains: Protein: ENSMUSP00000038186; Gene: ENSMUSG00000069830; AA Change: D573G

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Pfam:NACHT	133	302	4.6e-41	PFAM
low complexity region	482	494	N/A	INTRINSIC
LRR	632	659	4.53e-1	SMART
LRR	742	769	3.04e-5	SMART
low complexity region	856	870	N/A	INTRINSIC
Pfam:FIIND	921	1173	1.6e-102	PFAM
Pfam:CARD	1209	1292	2.3e-20	PFAM

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
  (Using ENSMUST00000048514)
• SMART Domains: Protein: ENSMUSP00000104158; Gene: ENSMUSG00000069830; AA Change: D573G

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Pfam:NACHT	133	302	1.1e-40	PFAM
low complexity region	482	494	N/A	INTRINSIC
LRR	632	659	4.53e-1	SMART
LRR	661	688	2.85e1	SMART
LRR	689	716	3.04e-5	SMART
Pfam:FIIND	819	1073	3e-136	PFAM
Pfam:CARD	1091	1174	8.2e-20	PFAM

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
  (Using ENSMUST00000108518)
• Meta Mutation Damage Score: 0.6534
• Is this an essential gene?: Probably nonessential (E-score: 0.088)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:40 PM by Anne Murray
• Record Created: 2017-03-22 3:19 PM by Xue Zhong
• Record Posted: 2018-07-27
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Aijie Liu, Jin Huk Choi, Beibei Fang, Tao Yue, Ying Wang, Emre Turer, Zhao Zhang, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001004142; MGI:2684861

Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (ENU)(1) Chemically induced (other)(1) Targeted(4)

Phenotypic Description

Figure 1. Watermelon mice exhibit reduced B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Watermelon mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Watermelon mice exhibit decreased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Watermelon mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Watermelon mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Watermelon mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Watermelon mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Watermelon mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Watermelon mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Watermelon mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Watermelon mice exhibit decreased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Watermelon mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Watermelon mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Watermelon mice exhibited increased TNFα secretion in response to the TLR7 ligand, R848. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Watermelon mice exhibited reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Watermelon mice exhibited increased macrophage necroptosis in response to TLR4 ligand, LPS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Watermelon mice exhibited increased levels of total IgE in the serum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The watermelon phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5009, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2), IgD+ B cells (Figure 3), and IgM+ B cells (Figure 4) with a lesser diminution of T cells (Figure 5). The CD4 to CD8 T cell ratio was increased due to reduced frequencies of CD8+ T cells (Figure 6) and central memory CD8 T cells in CD8 T cells (Figure 7) with increased frequencies of effector memory CD8 T cells in CD8 T cells (Figure 8) and lesser diminution of naïve CD4 T cells in CD4 T cells (Figure 9). The frequencies of B2 cells (Figure 10), natural killer cells (Figure 11), and B1 cells (Figure 12) were reduced and the frequencies of B1b cells (Figure 13) in the peripheral blood were increased. Some mice showed increased TNFα secretion in response to the TLR7 ligand R848 (Figure 14).  Some mice exhibited reduced body weights compared to wild-type littermates (Figure 15). The rate of macrophage necroptosis in response to LPS was increased (Figure 16) and the level of total IgE in the serum was increased (Figure 17).

Nature of Mutation

Figure 18. Linkage mapping of the IgE phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 87 mutations (X-axis) identified in the G1 male of pedigree R5009. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 87 mutations. All of the above phenotypes were linked by continuous variable mapping to mutations in two genes on chromosome 11: Rcvrn and Nlrp1a. The mutation in Nlrp1a was presumed causative, and is an A to G transition at base pair 71,122,705 (v38) on chromosome 11, or base pair 22,269 in the GenBank genomic region NC_000077 encoding Nlrp1a.  The strongest association was found with a recessive model of inheritance to the IgE phenotype, wherein two homozygous variant mice departed phenotypically from seven homozygous reference mice and 13 heterozygous mice with a P value of 2.264 x 10^-10 (Figure 18).   

The mutation corresponds to residue 1,936 in the mRNA sequence NM_001004142 within exon 3 of 14 total exons.

1920 CTGGTGATACAGACAGACATGGACCTCATGGTG 568  -L--V--I--Q--T--D--M--D--L--M--V-

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at amino acid 573 (D573G) in the NLRP1A protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.075).

Protein Prediction

Figure 19. Domain structure of the NLRP1A protein. The watermelon mutation results in an aspartic acid to glycine substitution at amino acid 573. The image is interactive. Click each mutation to view more information. Abbreviations: NACHT, NAIP, CIITA, HET-E and TP1 domain; LRR, leucine-rich repeat region; FIIND, function to find; CARD, caspase recruitment domain

NLRP1A (alternatively, Nalp1, Nalp1a, or NLRP1 [in humans]) is a member of the NLR (nucleotide-binding domain [NBD] and leucine-rich repeat [LRR]) protein family (1-4). NLR proteins can be classified as NLRBs (NLR containing the baculovirus inhibitory (BIR) domain), NLRCs (NLRs containing the caspase-recruitment domain (CARD) domain; see the record for inwood for information about Nlrc4), or NLRPs (NLRs containing the PYD domain; see the record Nd1 for information about Nlrp3) (4). Nlrp1a is one of three NLRP1 paralogs in the mouse: Nlrp1a, Nlrp1b, and Nlrp1c. The Nlrp1 paralogs are arranged in tandem on chromosome 11. NLRP1A and NLRP1B contain domains characteristic of mouse NLRs, but NLRP1C is truncated and lacks the CARD domain. The three proteins share over 70% homology.

NLRP1A has several domains similar to other NLRs, including a central oligomerization NACHT domain, a leucine-rich repeat (LRR) region, a FIIND (function to find) domain (alternatively, ZU5 and UPA domains) and a CARD (caspase recruitment) domain (Figure 19). Human NLRP1 has an N-terminal pyrin domain; however, rodent NLRP1 proteins do not have the pyrin domain. The pyrin domain bears similarity to death domains (DDs), death effector domains (DEDs), and CARDs that are found in many proteins involved in apoptosis and inflammation. All of these domains function in protein-protein interactions (e.g., with the scaffold protein ASC [(apoptosis-associated speck-like protein)]) and contain an antiparallel six-helical bundle with Greek-key topology and internal pseudo-twofold symmetry (5). Instead of the pyrin domain, rodent NLRP1 proteins have a region termed NR100; the NR100 region has little homology to domains of other NLRs. The NR100 region is predicted to confer the rodent-specific sensitivity to Bacillus anthracis lethal toxin (6). The NR100 domain is cleaved by lethal toxin, leading to toxin-mediated inflammasome activation (6).

The NACHT domain is a predicted nucleotide triphosphatase (NTPase) domain. In NLR proteins, the NACHT and NAD, also known as the NBD (nucleotide-binding domain), consists of twelve distinct conserved motifs, including the ATP/GTPase specific P-loop (Walker A motif), and the magnesium (Mg²⁺)-binding site (Walker B motif) (7;8). The Walker A motif contains the sequence GKS/T with the lysine coordinating the γ-phosphate of NTPs (9;10). The unique features of the NACHT domain include the prevalence of small residues (glycine, alanine or serine) directly C-terminal of the Mg²⁺-coordinating aspartate in the Walker B motif, in place of a second acidic residue prevalent in other NTPases. A second acidic residue is typically found in the NACHT-containing proteins two positions downstream. Distal to the Walker A and B motifs, these domains also a conserved pattern of polar, aromatic and hydrophobic residues that is not seen in any other NTPase family (7). 

LRR-containing domains generally consist of 2 to 45 motifs of 20 to 30 amino acids (11). LRRs occur in many proteins, providing a structural framework for the formation of protein-protein interactions. Sequence analyses of LRR proteins suggests the existence of several different subfamilies of LRRs (12), but all major classes of LRRs have curved horseshoe structures with a parallel β-sheet on the concave side and mostly helical elements on the convex side. Eleven-residue segments of the LRRs (LxxLxLxxN/CxL), corresponding to the β-strand and adjacent loop regions, are conserved in LRR proteins, whereas the remaining parts of the repeats may be very different. Despite the differences, each of the variable parts contain two half-turns at both ends and a "linear" segment, usually formed by a helix, in the middle. The concave face and the adjacent loops are the most common protein interaction surfaces on LRR proteins. Three-dimensional structures of some LRR protein-ligand complexes show that the concave surface of LRR domain is ideal for interaction with α-helical structures. Molecular modeling suggests that the conserved pattern LxxLxL, which is shorter than the previously proposed LxxLxLxxN/CxL, is sufficient to impart the characteristic horseshoe curvature to proteins with 20- to 30-residue repeats (11;12). 

In mouse NLRP1B, the FIIND domain confers intra-proteolytic activity, causing cleavage of the NLRP1B protein. Autoproteolysis is required, but not sufficient, for NLRP1B inflammasome activation in response to anthrax lethal toxin (13;14). The function of the FIIND domain in NLRP1A is unknown.

The CARD domain of NLRP1A mediates the specificity of NLRP1A protein-protein interactions with other CARD-containing proteins (e.g., caspase-1) to facilitate assembly into complexes (15). CARD domains have six or seven antiparallel alpha-helices and are similar in structure to death domains and death effector domains found in death receptors [e.g., Fas (see the record for cherry) and CDV40 (see the record for bluebonnet)], which facilitate the activation of caspase-8 and caspase-10 (16).

The watermelon mutation results in an aspartic acid to glycine substitution at amino acid 573 (D573G) in the NLRP1A protein; amino acid 573 is within an undefined region between the NACHT and LRR domains.

Expression/Localization

Nlrp1a is expressed in the majority of C57BL/6J (anthrax lethal toxin-resistant) tissues, but was not expressed in tissues from Balb/cJ mice (anthrax lethal toxin-sensitive) (17). Nlrp1a is expressed in lethal toxin-resistant macrophages in C57BL/6J, A/J, I/LnJ, C57BL/6Tac Nlrp^R/R, AKR/J, NOD/LtJ, DBA/2J, PWD/PhJ, PWK/PhJ, and SPRET/EiJ strains (17). Lethal toxin-sensitive macrophages from CAST/EiJ strain also expressed Nlrp1a. However, lethal toxin-sensitive macrophages from BALB/cJ, SWR/J, FVB/NJ, 129S1/SvImJ, C57BL/6Tac Nlrp^S/S, and C57/LJ strains did not express Nlrpa.

Background

Figure 20. NLRP1A inflammasome . The NLRP1 inflammasome is activated by Bacillus anthracis lethal toxin, Toxoplasma gondii , and host intracellular ATP depletion. The activator of the mouse NLRP1A inflammasome is unknown. NLRP1 primarily functions in caspase-1 and -5 activation, which subsequently activate L-1β and IL-18, causing apoptosis.

Certain members of the NLR family, including NLRP1A, NLRP1B, NLRP3 (see the record for ND1), and NLRC4 (see the record for inwood) are able to oligomerize through their NBD domains and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection danger signals in the cytoplasm. Inflammasome assembly has now been shown to be activated in response to diverse agents that include pathogens, DNA, single-stranded (ss) RNA, double-stranded (ds) RNA, bacterial toxins, and environmental irritants as well as endogenous danger signals [reviewed by (18;19)]. Caspase-1 is a cysteine protease that is present under resting conditions in an inactive precursor form with an N-terminal CARD-containing prodomain capable of mediating homotypic interactions. The CARD domain of procaspase-1 recruits the protease to the inflammasome where it undergoes autoproteolytic maturation into its active form. Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes in by activating key processes such as the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK) pathways.

The NLRP1 inflammasome is activated by various stimuli, including Bacillus anthracis lethal toxin (only known rodent NLRP1B activator; does not activate human NLRP1 inflammasome) (20), Toxoplasma gondii (21;22), and host intracellular ATP depletion (23) (Figure 20). The activator of the mouse NLRP1A inflammasome is unknown. NLRP1 primarily functions in caspase-1 and -5 activation, which subsequently activate L-1β and IL-18, causing apoptosis.

Mutations in NLRP1 are linked to autoinflammation with arthritis and dyskeratosis (AIADK; OMIM: #617388; (24)), multiple self-healing palmoplantar carcinoma (MSPC; OMIM: #615255; (25;26)), and susceptibility to vitiligo-associated multiple autoimmune disease (OMIM: #606579; (27)). Patients with AIADK exhibit recurrent fevers, widespread skin dyskeratosis, arthritis, elevated biologic markers of inflammation, and mild autoimmunity (24). Patients with MSPC exhibit recurrent keratoacanthomas in palmoplantar skin as well as in conjunctival and corneal epithelia (26). Patients also experience a high susceptibility to malignant squamous cell carcinoma (26). Vitiligo is an autoimmune disease characterized by melanocyte loss, which results in patchy depigmentation of skin and hair, and is associated with an elevated risk of other autoimmune diseases. 

Putative Mechanism

Homozygous mice expressing an ENU-induced Nlrp1a-induced mutation (Q593P) exhibit premature death by 3 to 5 months of age (28). The Nlrp1a^Q593P/Q593P mice exhibit increased numbers of neutrophils with concomitant reduced numbers of lymphocytes and macrophages (28). The Nlrp1a^Q593P/Q593P spleen is enlarged and several organs exhibit neutrophilic inflammatory disease (e.g., myocarditis, inflammatory bowel disease, pancreas inflammation, meningitis, liver inflammation, and pneumonitis) (28).

The phenotype of the watermelon mice indicates loss of NLRP1A^watermelon function.

Primers

PCR Primer
watermelon_pcr_F: GTGGGATCATGGGATTCACAG
watermelon_pcr_R: CCTGCAGCCTTCATGGAAAG

Sequencing Primer
watermelon_seq_F: TGGGATCATGGGATTCACAGATAATC
watermelon_seq_R: TGGCACATCCTAGGGAAATCC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 406 nucleotides is amplified (chromosome 11, - strand):

1   cctgcagcct tcatggaaag acaaagttga aactactatg gcacatccta gggaaatccc
61  aaccccatca accaccttgc ctgggtttgc tccactgtct gtatgaaaat caggatatgg
121 agctcctgac acacgtgatg catgatctgc aaggaacaat agtgcctgga ccagatgatt
181 tggcacacac agtgttgcag acaaacgtga agcacctggt gatacagaca gacatggacc
241 tcatggtggt tactttctgc attaagttct gctgtcacgt gaggagtctt cagctgaaca
301 ggaaggtaca gcagggacat aagtttacgg cccctgggat ggttctgtga gtatctatct
361 agacacaacc cactctccag attatctgtg aatcccatga tcccac

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Damiano, J. S., Stehlik, C., Pio, F., Godzik, A., and Reed, J. C. (2001) CLAN, a Novel Human CED-4-Like Gene. Genomics. 75, 77-83.

  2. Geddes, B. J., Wang, L., Huang, W. J., Lavellee, M., Manji, G. A., Brown, M., Jurman, M., Cao, J., Morgenstern, J., Merriam, S., Glucksmann, M. A., DiStefano, P. S., and Bertin, J. (2001) Human CARD12 is a Novel CED4/Apaf-1 Family Member that Induces Apoptosis. Biochem Biophys Res Commun. 284, 77-82.

  3. Poyet, J. L., Srinivasula, S. M., Tnani, M., Razmara, M., Fernandes-Alnemri, T., and Alnemri, E. S. (2001) Identification of Ipaf, a Human Caspase-1-Activating Protein Related to Apaf-1. J Biol Chem. 276, 28309-28313.

  4. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.

  5. Srinivasula, S. M., Poyet, J. L., Razmara, M., Datta, P., Zhang, Z., and Alnemri, E. S. (2002) The PYRIN-CARD Protein ASC is an Activating Adaptor for Caspase-1. J Biol Chem. 277, 21119-21122.

  6. Levinsohn, J. L., Newman, Z. L., Hellmich, K. A., Fattah, R., Getz, M. A., Liu, S., Sastalla, I., Leppla, S. H., and Moayeri, M. (2012) Anthrax Lethal Factor Cleavage of Nlrp1 is Required for Activation of the Inflammasome. PLoS Pathog. 8, e1002638.

  7. Koonin, E. V., and Aravind, L. (2000) The NACHT Family - a New Group of Predicted NTPases Implicated in Apoptosis and MHC Transcription Activation. Trends Biochem Sci. 25, 223-224.

  8. Harton, J. A., Linhoff, M. W., Zhang, J., and Ting, J. P. (2002) Cutting Edge: CATERPILLER: A Large Family of Mammalian Genes Containing CARD, Pyrin, Nucleotide-Binding, and Leucine-Rich Repeat Domains. J Immunol. 169, 4088-4093.

  9. Anderson, J. P., Mueller, J. L., Rosengren, S., Boyle, D. L., Schaner, P., Cannon, S. B., Goodyear, C. S., and Hoffman, H. M. (2004) Structural, Expression, and Evolutionary Analysis of Mouse CIAS1. Gene. 338, 25-34.

  10. Duncan, J. A., Bergstralh, D. T., Wang, Y., Willingham, S. B., Ye, Z., Zimmermann, A. G., and Ting, J. P. (2007) Cryopyrin/NALP3 Binds ATP/dATP, is an ATPase, and Requires ATP Binding to Mediate Inflammatory Signaling. Proc Natl Acad Sci U S A. 104, 8041-8046.

  11. Enkhbayar, P., Kamiya, M., Osaki, M., Matsumoto, T., and Matsushima, N. (2004) Structural Principles of Leucine-Rich Repeat (LRR) Proteins. Proteins. 54, 394-403.

  12. Kajava, A. V., and Kobe, B. (2002) Assessment of the Ability to Model Proteins with Leucine-Rich Repeats in Light of the Latest Structural Information. Protein Sci. 11, 1082-1090.

  13. Frew, B. C., Joag, V. R., and Mogridge, J. (2012) Proteolytic Processing of Nlrp1b is Required for Inflammasome Activity. PLoS Pathog. 8, e1002659.

  14. D'Osualdo, A., Weichenberger, C. X., Wagner, R. N., Godzik, A., Wooley, J., and Reed, J. C. (2011) CARD8 and NLRP1 Undergo Autoproteolytic Processing through a ZU5-Like Domain. PLoS One. 6, e27396.

  15. Jin, T., Curry, J., Smith, P., Jiang, J., and Xiao, T. S. (2013) Structure of the NLRP1 Caspase Recruitment Domain Suggests Potential Mechanisms for its Association with Procaspase-1. Proteins. 81, 1266-1270.

  16. Aravind, L., Dixit, V. M., and Koonin, E. V. (1999) The Domains of Death: Evolution of the Apoptosis Machinery. Trends Biochem Sci. 24, 47-53.

  17. Sastalla, I., Crown, D., Masters, S. L., McKenzie, A., Leppla, S. H., and Moayeri, M. (2013) Transcriptional Analysis of the Three Nlrp1 Paralogs in Mice. BMC Genomics. 14, 188-2164-14-188.

  18. Schroder, K., Zhou, R., and Tschopp, J. (2010) The NLRP3 Inflammasome: A Sensor for Metabolic Danger? Science. 327, 296-300.

  19. Tschopp, J., and Schroder, K. (2010) NLRP3 Inflammasome Activation: The Convergence of Multiple Signalling Pathways on ROS Production? Nat Rev Immunol. 10, 210-215.

  20. Nour, A. M., Yeung, Y. G., Santambrogio, L., Boyden, E. D., Stanley, E. R., and Brojatsch, J. (2009) Anthrax Lethal Toxin Triggers the Formation of a Membrane-Associated Inflammasome Complex in Murine Macrophages. Infect Immun. 77, 1262-1271.

  21. Ewald, S. E., Chavarria-Smith, J., and Boothroyd, J. C. (2014) NLRP1 is an Inflammasome Sensor for Toxoplasma Gondii. Infect Immun. 82, 460-468.

  22. Gorfu, G., Cirelli, K. M., Melo, M. B., Mayer-Barber, K., Crown, D., Koller, B. H., Masters, S., Sher, A., Leppla, S. H., Moayeri, M., Saeij, J. P., and Grigg, M. E. (2014) Dual Role for Inflammasome Sensors NLRP1 and NLRP3 in Murine Resistance to Toxoplasma Gondii. MBio. 5, 10.1128/mBio.01117-13.

  23. Liao, K. C., and Mogridge, J. (2013) Activation of the Nlrp1b Inflammasome by Reduction of Cytosolic ATP. Infect Immun. 81, 570-579.

  24. Grandemange, S., Sanchez, E., Louis-Plence, P., Tran Mau-Them, F., Bessis, D., Coubes, C., Frouin, E., Seyger, M., Girard, M., Puechberty, J., Costes, V., Rodiere, M., Carbasse, A., Jeziorski, E., Portales, P., Sarrabay, G., Mondain, M., Jorgensen, C., Apparailly, F., Hoppenreijs, E., Touitou, I., and Genevieve, D. (2017) A New Autoinflammatory and Autoimmune Syndrome Associated with NLRP1 Mutations: NAIAD (NLRP1-Associated Autoinflammation with Arthritis and Dyskeratosis). Ann Rheum Dis. 76, 1191-1198.

  25. Soler, V. J., Tran-Viet, K. N., Galiacy, S. D., Limviphuvadh, V., Klemm, T. P., St Germain, E., Fournie, P. R., Guillaud, C., Maurer-Stroh, S., Hawthorne, F., Suarez, C., Kantelip, B., Afshari, N. A., Creveaux, I., Luo, X., Meng, W., Calvas, P., Cassagne, M., Arne, J. L., Rozen, S. G., Malecaze, F., and Young, T. L. (2013) Whole Exome Sequencing Identifies a Mutation for a Novel Form of Corneal Intraepithelial Dyskeratosis. J Med Genet. 50, 246-254.

  26. Zhong, F. L., Mamai, O., Sborgi, L., Boussofara, L., Hopkins, R., Robinson, K., Szeverenyi, I., Takeichi, T., Balaji, R., Lau, A., Tye, H., Roy, K., Bonnard, C., Ahl, P. J., Jones, L. A., Baker, P., Lacina, L., Otsuka, A., Fournie, P. R., Malecaze, F., Lane, E. B., Akiyama, M., Kabashima, K., Connolly, J. E., Masters, S. L., Soler, V. J., Omar, S. S., McGrath, J. A., Nedelcu, R., Gribaa, M., Denguezli, M., Saad, A., Hiller, S., and Reversade, B. (2016) Germline NLRP1 Mutations Cause Skin Inflammatory and Cancer Susceptibility Syndromes Via Inflammasome Activation. Cell. 167, 187-202.e17.

  27. Jin, Y., Mailloux, C. M., Gowan, K., Riccardi, S. L., LaBerge, G., Bennett, D. C., Fain, P. R., and Spritz, R. A. (2007) NALP1 in Vitiligo-Associated Multiple Autoimmune Disease. N Engl J Med. 356, 1216-1225.

  28. Masters, S. L., Gerlic, M., Metcalf, D., Preston, S., Pellegrini, M., O'Donnell, J. A., McArthur, K., Baldwin, T. M., Chevrier, S., Nowell, C. J., Cengia, L. H., Henley, K. J., Collinge, J. E., Kastner, D. L., Feigenbaum, L., Hilton, D. J., Alexander, W. S., Kile, B. T., and Croker, B. A. (2012) NLRP1 Inflammasome Activation Induces Pyroptosis of Hematopoietic Progenitor Cells. Immunity. 37, 1009-1023.