Phenotypic Mutation 'whisper3'

• Allele: whisper3
• Mutation Type: missense
• Chromosome: 11
• Coordinate: 80,557,521 bp (GRCm38)
• Base Change: T ⇒ A (forward strand)
• Gene: Myo1d
• Gene Name: myosin ID
• Synonym(s): 9930104H07Rik, D11Ertd9e
• Chromosomal Location: 80,482,126-80,780,025 bp (-)
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000037819]
• AlphaFold: Q5SYD0
• SMART Domains: Protein: ENSMUSP00000037819; Gene: ENSMUSG00000035441; AA Change: D926V

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000041065)
• Meta Mutation Damage Score: 0.9431
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:40 PM by Anne Murray
• Record Created: 2017-03-27 10:43 AM
• Record Posted: 2018-10-11
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: William McAlpine, Emre Turer, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_177390; MGI:107728

Alleles Listed at MGI

All alleles(6) : Targeted(5) Gene trapped(1)

Phenotypic Description

Figure 1. Whisper3 mice exhibited susceptibility to DSS-induced colitis at day 7 post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Whisper3 mice exhibited susceptibility to DSS-induced colitis at day 10 post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The whisper3 phenotype was identified among G3 mice of the pedigree R5042, some of which showed susceptibility to dextran sulfate sodium (DSS)-induced colitis exhibiting diarrhea and rectal bleeding as well as weight loss by seven days after exposure to DSS (Figure 1); weight loss continued to progress through day 10 post-DSS treatment (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the day 10 DSS susceptibility phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 53 mutations (X-axis) identified in the G1 male of pedigree R5042. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 53 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Myo1d: an A to T transversion at base pair 80,557,521 (v38) on chromosome 11 corresponding to base pair 222,535 in the GenBank genomic region NC_000077 encoding Myo1d. The strongest association was found with a recessive model of linkage to the DSS-induced weight loss at day 10, wherein seven affected variant homozygotes departed phenotypically from 11 homozygous reference mice and 16 heterozygous mice with a P value of 8.026 x 10^-5 (Figure 3).

 

The mutation corresponds to residue 3,010 in the mRNA sequence NM_177390 within exon 21 of 22 total exons.

 

2994 ACAAAAGACAACAAAGACCTCATTGTCTGCCTC 921  -T--K--D--N--K--D--L--I--V--C--L-

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid to valine substitution at position 926 (D926V) in the Myo1d protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 1.00).

Protein Prediction

Figure 4. Domain structure of myosin 1D.  The head domain contains the actin-binding (not shown) and ATP-binding sites and generates force.  A central neck domain or light-chain binding domain contains two calmodulin binding IQ motifs.  The C-terminal half of myosin 1D consists of tail homology-1 (TH1) domain. The whisper3 mutation is an aspartic acid to valine substitution at position 926 (D926V) (red asterisk). This image is interactive. Click on the image to view another mutation found in Myo1d (red). Click on the mutations for more specific information.

Myo1d encodes myosin 1D (Myo1d; alternatively, Myr4), a member of the class I family of unconventional myosins (Figure 4). The class I myosins are molecular motors that control the mechanical properties of cell membranes by mediating membrane/cytoskeleton adhesion (1). The whisper3 mutation (D926V) is within the TH1 domain of Myo1d. The TH1 domain in class I myosins mediates myosin dimerization, targets each myosin to its subcellular location, binds directly to acidic phospholipids, and specifies the function(s) (e.g., cargo binding and enzymatic activities) of a myosin (2;3).

 

For more information on Myo1d, please see the record for horton.

Putative Mechanism

The apical brush border of the intestinal epithelial cells that line the small intestine is comprised of tightly packed microvilli (4). A core actin bundle and associated actin-binding proteins are essential to maintain the stability of each microvillus (4). Unconventional myosins in the intestine have been studied. Myosin-1a (Myo1a) connects the microvillar membrane to the actin bundle underneath (5-7). Myosins from classes I, II, V, VI, and VII also target to the actin-rich domain in the brush border (8;9). Myo1a has several functions within the enterocyte including the organization of apical membrane domains (10), controlling apical membrane tension (1), and the shedding of vesicles from the tips of the microvilli (11). Knockout of Myo1a (Myo1a^-/-) in mice resulted in defects in the brush border membrane composition and apical membrane herniations in some enterocyte brush borders (12), but the knockout mice exhibited no noticeable physiological symptoms indicating that other myosins may compensate for Myo1a. In the wild-type microvillus, Myo1a is excluded from the distal tip compartment where Myo1d localized, indicating that Myo1a and Myo1d have different functions within the microvillus (4). In Myo1a^-/- mice, the levels of Myo1d in the brush border are upregulated and redistributed along the length of the microvillus (4). The redistribution of Myo1d upon the loss of Myo1a expression indicates that Myo1d can compensate for the function of Myo1a in the brush border (4). Benesh et al. propose that Myo1d functions in the early stages of vesicle formation at the tips of the microvilli and that the redistribution of Myo1d upon loss of Myo1a expression indicates that Myo1d and Myo1a may compete for a shared binding site within the microvillus (4). The localization of Myo1d to the terminal web, a filamentous structure at the apical surface of epithelial cells that possess microvilli, indicates that Myo1d may function in the short-range transport, docking, and/or fusion of apically directed vesicles derived from the Golgi (13). The Myo1d at the tips of the microvilli may function to control actin dynamics or to transport components along the microvillar axis (4). Alternatively, Myo1d may also function in the formation and/or release of vesicles from the microvillar tips (14).

Primers

PCR Primer
whisper3_pcr_F: GCCGGATGCTAATTTCACCTTC
whisper3_pcr_R: CTCCTTACTCCATGAAACTTGTTAAAG

Sequencing Primer
whisper3_seq_F: AAAGATGCTTTAATTTGTCCTTGTGG
whisper3_seq_R: GGTTAAAATCGTCACCATCGTTGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 433 nucleotides is amplified (chromosome 11, - strand):

1   ctccttactc catgaaactt gttaaaggtt aaaatcgtca ccatcgttgc tatggcctgc
61  tctaattcat tcttccagga gataccctaa cagcctctgt gtgttccctc cttgcagttg
121 actggtctga gtgtctccaa tggaaaggac caacttgtag tgttccatac aaaagacaac
181 aaagacctca ttgtctgcct cttcagcaaa cagccaaccc atgagagtcg tattggagaa
241 cttgttggag tcctggtgaa tcatttcaag aggtaaaatt ttatttttgt agataaaaga
301 caacttttaa atacacaaaa tgttgaatca tacttatcac taaccttggt ttgtgccaat
361 gtgaatatat tgttttcctc cacaaggaca aattaaagca tctttttcat agaaggtgaa
421 attagcatcc ggc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Nambiar, R., McConnell, R. E., and Tyska, M. J. (2009) Control of Cell Membrane Tension by Myosin-I. Proc Natl Acad Sci U S A. 106, 11972-11977.

  2. Hasson, T., Skowron, J. F., Gilbert, D. J., Avraham, K. B., Perry, W. L., Bement, W. M., Anderson, B. L., Sherr, E. H., Chen, Z. Y., Greene, L. A., Ward, D. C., Corey, D. P., Mooseker, M. S., Copeland, N. G., and Jenkins, N. A. (1996) Mapping of Unconventional Myosins in Mouse and Human. Genomics. 36, 431-439.

  3. McConnell, R. E., and Tyska, M. J. (2010) Leveraging the Membrane - Cytoskeleton Interface with Myosin-1. Trends Cell Biol. 20, 418-426.

  4. Benesh, A. E., Nambiar, R., McConnell, R. E., Mao, S., Tabb, D. L., and Tyska, M. J. (2010) Differential Localization and Dynamics of Class I Myosins in the Enterocyte Microvillus. Mol Biol Cell. 21, 970-978.

  5. Mooseker, M. S., and Tilney, L. G. (1975) Organization of an Actin Filament-Membrane Complex. Filament Polarity and Membrane Attachment in the Microvilli of Intestinal Epithelial Cells. J Cell Biol. 67, 725-743.

  6. Matsudaira, P. T., and Burgess, D. R. (1979) Identification and Organization of the Components in the Isolated Microvillus Cytoskeleton. J Cell Biol. 83, 667-673.

  7. Howe, C. L., and Mooseker, M. S. (1983) Characterization of the 110-Kdalton Actin-Calmodulin-, and Membrane-Binding Protein from Microvilli of Intestinal Epithelial Cells. J Cell Biol. 97, 974-985.

  8. Chen, Z. Y., Hasson, T., Zhang, D. S., Schwender, B. J., Derfler, B. H., Mooseker, M. S., and Corey, D. P. (2001) Myosin-VIIb, a Novel Unconventional Myosin, is a Constituent of Microvilli in Transporting Epithelia. Genomics. 72, 285-296.

  9. Heintzelman, M. B., Hasson, T., and Mooseker, M. S. (1994) Multiple Unconventional Myosin Domains of the Intestinal Brush Border Cytoskeleton. J Cell Sci. 107 ( Pt 12), 3535-3543.

  10. Tyska, M. J., and Mooseker, M. S. (2002) MYO1A (Brush Border Myosin I) Dynamics in the Brush Border of LLC-PK1-CL4 Cells. Biophys J. 82, 1869-1883.

  11. McConnell, R. E., Higginbotham, J. N., Shifrin, D. A.,Jr, Tabb, D. L., Coffey, R. J., and Tyska, M. J. (2009) The Enterocyte Microvillus is a Vesicle-Generating Organelle. J Cell Biol. 185, 1285-1298.

  12. Tyska, M. J., Mackey, A. T., Huang, J. D., Copeland, N. G., Jenkins, N. A., and Mooseker, M. S. (2005) Myosin-1a is Critical for Normal Brush Border Structure and Composition. Mol Biol Cell. 16, 2443-2457.

  13. Fath, K. R., and Burgess, D. R. (1993) Golgi-Derived Vesicles from Developing Epithelial Cells Bind Actin Filaments and Possess Myosin-I as a Cytoplasmically Oriented Peripheral Membrane Protein. J Cell Biol. 120, 117-127.

  14. McConnell, R. E., and Tyska, M. J. (2007) Myosin-1a Powers the Sliding of Apical Membrane Along Microvillar Actin Bundles. J Cell Biol. 177, 671-681.