Phenotypic Mutation 'hallon'

• Allele: hallon
• Mutation Type: critical splice donor site
• Chromosome: 2
• Coordinate: 163,941,747 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Stk4
• Gene Name: serine/threonine kinase 4
• Synonym(s): sterile 20-like kinase 1, Kas-2, Ysk3, Mst1
• Chromosomal Location: 163,916,033-163,997,444 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000018353 ^†] † probably from a misspliced transcript
• AlphaFold: Q9JI11
• SMART Domains: Protein: ENSMUSP00000018353; Gene: ENSMUSG00000018209

Domain	Start	End	E-Value	Type
S_TKc	30	281	1.97e-104	SMART
low complexity region	311	326	N/A	INTRINSIC
Pfam:Mst1_SARAH	433	480	2.4e-26	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000116745; Gene: ENSMUSG00000018209

Domain	Start	End	E-Value	Type
Blast:S_TKc	2	26	8e-6	BLAST
PDB:3COM|B	2	26	4e-7	PDB
low complexity region	27	42	N/A	INTRINSIC

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9498
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:40 PM by Diantha La Vine
• Record Created: 2017-03-31 9:40 AM by Xue Zhong
• Record Posted: 2018-08-15
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, Aijie Liu, Evan Nair-Gill, Takuma Misawa, Ying Wang, Tao Yue, Zhao Zhang and Bruce Beutler

Accession Number

NCBI RefSeq: NM_021420; MGI:1929004

Alleles Listed at MGI

All Mutations and Alleles(53) : Chemically induced (ENU)(2) Gene trapped(38) Targeted(13)

Phenotypic Description

Figure 1. Hallon mice exhibit reduced frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Hallon mice exhibit an increase in the CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Hallon mice exhibit reduced frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Hallon mice exhibit reduced frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Hallon mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Hallon mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Hallon mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Hallon mice exhibit reduced IgD expression on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Hallon mice exhibit increased CD44 expression on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Hallon mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Hallon mice exhibit increased levels of OVA-specific IgE after OVA/alum challenge. ELISA analysis was utilized to determine IgE expression. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Homozygous hallon mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hallon phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4829, some of which showed a decrease in the frequency T cells (Figure 1) in the peripheral blood. Some mice also showed an increase in the CD4⁺ to CD8⁺ T cell ratio (Figure 2) due to a decrease in the frequency of CD4+ T cells (Figure 3) and a lesser diminution in the frequency of CD8+ T cells (Figure 4) in the peripheral blood. Some mice also showed an increased frequency of macrophages (Figure 5), neutrophils (Figure 6), and natural killer (NK) cells (Figure 7), all in the peripheral blood. Expression of IgD was reduced on the surface of peripheral blood B cells (Figure 8). CD44 expression on the surface of peripheral blood CD4+ (Figure 9) and CD8+ T cells (Figure 10) was increased. The level of OVA-specific IgE after OVA/Alum challenge was increased (Figure 11). The T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) was diminished (Figure 12). 

The phenotypes observed in the hallon mice were validated by CRISPR/Cas9 targeting of Stk4.

Nature of Mutation

Figure 13. Linkage mapping of the increased CD44 MFI on CD8+ T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 101 mutations (X-axis) identified in the G1 male of pedigree R4829. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 101 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Stk4: a T to C transition at base pair 164,099,827 (v38) on chromosome 2, or base pair 25,715 in the GenBank genomic region NC_000068 within the donor splice site of intron 8. The strongest association was found with a recessive model of linkage to the expression of CD44 on CD8+ T cells, wherein six variant homozygotes departed phenotypically from 19 homozygous reference mice and 28 heterozygous mice with a P value of 5.355 x 10^-19 (Figure 13).  A strong semidominant effect was observed in most of the assays, but the mutation is predominantly recessive. A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of cryptic splice site within intron 8. The resulting transcript would have a 62-base pair insertion of intron 8, which would cause a frame shifted protein beginning after amino acid 319 of the protein. The protein would terminate after the inclusion of 43 aberrant amino acids.

<--exon 7      <--exon 8 intron 8-->          exon 9-->       <--exon 11 24453 ……CAGCTCCTACAG ……GAGGAGAACTCA gtgagtggctgctctctg…… GAGGAGGATGAA……CAGAACTTCTGA 274   ……-Q--L--L--Q- ……-E--E--N--S-                      -E--E--D--E-……-Q--N--F--*- 487

Genomic numbering corresponds to NC_000068. The donor splice site of intron 8, which is destroyed by the hallon mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 14. Domain organization of MST1. The hallon mutation destroys the donor splice site of intron 8. Other mutations found in the MST1 protein are shown in red. Click on each mutation for more information. Abbreviations: CC, coiled-coil; SARAH, Salvador/Rassf/Hippo domain.

Stk4 encodes mammalian sterile 20-like kinase 1 (MST1; alternatively, serine/threonine protein kinase 4 [STK4]), a member of the MST family of kinases that also includes MST2 (STK3), MST3 (STK24), MST4 (STK26), and YSK1 (STK25) [reviewed in (1)].

MST1 has two domains, an N-terminal kinase domain and a C-terminal SARAH (Salvador/Rassf/Hippo) domain (Figure 14). The MST1 SARAH domain interacts with the SARAH domains of the tumor suppressors RASSF1 and RASSF5 (alternatively, Nore1), subsequently promoting apoptosis (2;3). The SARAH domain is also involved in dimerization (2). The SARAH domain has two helices (h1, amino acids 433 to 437; h2, amino acids 441 to 480). In a MST1 dimer the helices interact through hydrophobic interactions between amino acids 436, 439, 441, and 444 from one monomer and amino acids 473 and 477 from the other (2).

MST1 is autophosphorylated at Thr183 (see the Background section for more information) (4). The association of MST1/2 with RASSF1 and RASSF5 suppress MST1/2 autophosphorylation (4). Thr183 can also be phosphorylated by TAO kinases (TAOK1/2/3; see the record for taoist). MST1 is also phosphorylated by PKB/AKT1 at Thr387, which prevents MST1 activation, nuclear translocation, and Thr183 autophosphorylation (5;6). During apoptosis, MST1 is cleaved by caspase-3 at Asp326 to produce a 37-kDa form (5). Proteolytic cleavage of MST1 results in its activation and nuclear translocation (7;8).

The hallon mutation is predicted to result in a frame-shifted protein beginning after amino acid 319 of the protein and premature termination after the inclusion of 43 aberrant amino acids. The mutation would affect both the 37-kDa and 18-kDa forms of MST1.

Expression/Localization

A 7.0-kb STK4 transcript is ubiquitously expressed, while a 3.4-kb putative splice variant is highly expressed in kidney, placenta, and skeletal muscle (1). MST1 localizes to the cytoplasm, but the catalytic fragment of MST1 translocates to the nucleus.

Background

Figure 15. MST1 functions in both the YAP/TAZ and FOXO signaling pathways. Signals from GPCRs, the Wnt pathway, mechanical stress, tight junctions, adherent junctions, as well as some soluble growth factors promote the phosphorylation of MST1/2. MST1/2 phosphorylates LATS1/2, subsequently inhibiting the transcriptional function of YAP/TAZ by creating a 14-3-3 binding site, which promotes cytoplasmic localization of YAP/TAZ, resulting in YAP/TAZ cytoplasmic retention and degradation. In the FOXO signaling pathway, MST1/2 phosphorylates AKT and subsequently disrupts its function of interaction between FOXO3 with 14-3-3 proteins. In T cells, MST1/2 promotes T cell migration via the MST1-MOB1-DOCK8-Rac1 axis or by activating and clustering LFA-1 through DENND1C-RAB13, RIAM-Kindlin-3-Talin or VASP signaling. MST1/2 enhances Treg differentiation via promoting Foxp3’s acetylation and activity. In dendritice cells, MST1/2 modulates Th17 differentiation in an MST1/2-p38-IL6-IL-6R-STAT3-dependent manner. This image is interactive. Mutations found in the pathway are noted in red. Click on each mutation for more information.

MST1 is a serine/threonine kinase with both proaopototic and antiapoptotic functions in several systems, including the immune system (9;10), cardiovascular system (11;12), digestive system (13;14), respiratory system (15), and the central nervous system [reviewed in (16)]. MST1 and MST2 are mammalian orthologs of Drosophila Hippo. Hippo is within a pathway that restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasis. The Hippo pathway is activated by TAOK1/2/3 upon sensing of stressful stimuli (Figure 15). Upon Hippo pathway activation, the TAOKs phosphorylate Thr183 of MST1 (and Thr180 in MST2), resulting in MST1/2 activation (17). MST1/2 (in complex with the regulatory scaffold protein SAV1 [alternatively, WW45]) phosphorylate and activate large tumor suppressor 1/2 (LATS1/2). NF2/Merlin interacts with LATS1/2 and facilitates LATS1/2 phosphorylation by the MST1/2–SAV1 complex (18). G-protein-coupled receptors (GPCRs) can either activate (Gα_12/13 and Gα_q/11) or suppress (Gα_S) LATS1/2 (19). Cell polarity and architecture can also control LATS1/2 activation. Activated LATS1/2 in complex with the regulatory protein MOB1 subsequently phosphorylates and inactivates the oncoprotein Yes-associated protein-1 (YAP1) (see the record for Puddel_hunde) and the transcriptional coactivator with PDZ-binding motif (TAZ). YAP1 and TAZ phosphorylation promotes binding with 14-3-3 in the cytoplasm, preventing translocation of YAP1 and TAZ to the nucleus. LATS-induced YAP1 and TAZ phosphorylation induces YAP1/TAZ phosphorylation by casein kinase 1δ/ε, recruitment of the SCF E3 ubiquitin ligase, and subsequent YAP1/TAZ ubiquitination and degradation. When active, YAP1 and TAZ translocate to the nucleus to bind the TEAD transcription factor family (homologs of Drosophila Scalloped) and induce the expression of its target genes involved in cell proliferation, cell death, and cell migration.

MST1/2 can also activate the non-canonical Hippo signaling pathway through Mps one binder 1A and B (MOB1A/B) and/or NDR1/2 [reviewed in (20)]. The MST1/2-WW45 complex phosphorylates and activates the LATS1/2-MOB1A/B complex, which in turn phosphorylates YAP/TAZ. The MST1-MOB1-DOCK8 (see the record for captain_morgan)-Rac1 axis promotes T cell migration by activating and clustering LFA-1 through DENND1C-RAB13, RIAM-Kindlin-3-Talin, or VASP signaling. The MST1-NDR1 pathway phosphorylates TAZ to promote Th17 differentiation.

MST1/2 has several functions unrelated to Hippo signaling. MST1/2 can activate the JNK/SAPK pathway after actin cytoskeleton disruption to induce cell cycle arrest, apoptosis, or cell survival (21). MST1/2 promote neuronal cell death by phosphorylating (and activating) forkhead box O (FOXO) transcription factors in response to oxidative stress. The FOXO transcription factors subsequently promote the expression of proapoptotic genes (22). In cancer cells, MST1-FOXO1 promotes the transcription of the proapoptotic mediator NOXA to control apoptosis (23). MST1/2-mediated phosphorylation and subsequent stabilization of FOXA2 regulates pneumocyte maturation and surfactant homeostasis (15). The MST1-FOXO signaling pathway also maintains naïve T cell homeostasis and enhances Treg differentiation by promoting the acetylation and activity of Foxp3 (24). The 37-kDa MST1 fragment enters the nucleus and phosphorylates histones H2AX and H2B, which promotes chromatin condensation, DNA fragmentation, and subsequently apoptotic cell death (8;25;26).

Mutations in STK4 are linked to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations (OMIM: #614868) (27;28). Patients exhibit T- and B-cell lymphopenia, intermittent neutropenia, and atrial septal defects as well as recurring bacterial infections, viral infections, skin abscesses, cutaneous warts, and mucocutaneous candidiasis (28).

Putative Mechanism

Mice that lack either Stk3 or Stk4 are viable, but mice that lack both Stk3 and Stk4 (Stk3^-/-; Stk4^-/-) are not (29). The Stk3^-/-; Stk4^-/- mice exhibited growth retardation, failed placental development, impaired yolk sac/embryo vascular patterning and primitive hematopoiesis, increased apoptosis in placentas and embryos, and disorganized proliferating cells in the embryo. A liver-specific double-knockout model exhibits hepatomegaly and hepatocellular carcinoma.

Stk4-deficient (Stk4^-/-) mice exhibit progressive loss of T and B cells due to excessive apoptosis (29;30). Stk4^-/- mice have reduced numbers of naïve T cells in secondary lymphoid organs and in the peripheral blood. Stk4^-/- mice exhibited an accumulation of mature thymocytes in the thymus, a reduction of lymphocytes in blood and peripheral lymphoid tissues, and reduced ability to traffic to peripheral lymph nodes (9). Thymocytes from the Stk4^-/- mice showed diminished chemotactic responses to CCL19, but not S1P (9). Mature T cells from the Stk4^-/- mice exhibited a reduced capacity to egress from the thymus. Stk4^-/- mice also exhibited inefficient migration and antigen recognition of CD4+ T cells within the medulla (31). Stk4^-/- naïve T cells exhibited increased proliferation in response to T-cell receptor stimulation; the proliferative responses of Stk4^-/- effector/memory T cells were comparable to that in wild-type mice (30).

The phenotype of the hallon mice indicate loss of MST1 function.

Primers

PCR Primer
hallon_pcr_F: CAAACCGTGTCCATTGTTGTC
hallon_pcr_R: CTAGGGGATGTCTCTGTCTCTC

Sequencing Primer
hallon_seq_F: GTCCACTTTGTTATTTAAGCACCCG
hallon_seq_R: GGGATGTCTCTGTCTCTCACTGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 426 nucleotides is amplified (chromosome 2, + strand):

1   caaaccgtgt ccattgttgt ccactttgtt atttaagcac ccgtttgtta agagtgccaa
61  aggagtgtca atattgcgag acttaattaa cgaagccatg gatgtgaaac tgaagcgcca
121 ggaagcccag cagcgggaag tggaccagga cgacgaggag aactcagtga gtggctgctc
181 tctgctgggt caggggtgtg tacttcttag gtctcgcttg ccacagaggt cagctgagta
241 gctggtgtag tcagctcttt gttgagtgcg gatggatctc attcagtgct gctgggctcc
301 gctgccgggg ctatgcttgc tctttgctca gtgtttcctt aaaacacatt ttgttatttc
361 ccctgtatca tttatccaga ttatctattt atttaagaga cagtgagaga cagagacatc
421 ccctag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Thompson, B. J., and Sahai, E. (2015) MST Kinases in Development and Disease. J Cell Biol. 210, 871-882.

  2. Hwang, E., Ryu, K. S., Paakkonen, K., Guntert, P., Cheong, H. K., Lim, D. S., Lee, J. O., Jeon, Y. H., and Cheong, C. (2007) Structural Insight into Dimeric Interaction of the SARAH Domains from Mst1 and RASSF Family Proteins in the Apoptosis Pathway. Proc Natl Acad Sci U S A. 104, 9236-9241.

  3. Scheel, H., and Hofmann, K. (2003) A Novel Interaction Motif, SARAH, Connects Three Classes of Tumor Suppressor. Curr Biol. 13, R899-900.

  4. Praskova, M., Khoklatchev, A., Ortiz-Vega, S., and Avruch, J. (2004) Regulation of the MST1 Kinase by Autophosphorylation, by the Growth Inhibitory Proteins, RASSF1 and NORE1, and by Ras. Biochem J. 381, 453-462.

  5. Graves, J. D., Draves, K. E., Gotoh, Y., Krebs, E. G., and Clark, E. A. (2001) Both Phosphorylation and Caspase-Mediated Cleavage Contribute to Regulation of the Ste20-Like Protein Kinase Mst1 during CD95/Fas-Induced Apoptosis. J Biol Chem. 276, 14909-14915.

  6. Graves, J. D., Gotoh, Y., Draves, K. E., Ambrose, D., Han, D. K., Wright, M., Chernoff, J., Clark, E. A., and Krebs, E. G. (1998) Caspase-Mediated Activation and Induction of Apoptosis by the Mammalian Ste20-Like Kinase Mst1. EMBO J. 17, 2224-2234.

  7. Lee, K. K., Ohyama, T., Yajima, N., Tsubuki, S., and Yonehara, S. (2001) MST, a Physiological Caspase Substrate, Highly Sensitizes Apoptosis both Upstream and Downstream of Caspase Activation. J Biol Chem. 276, 19276-19285.

  8. Ura, S., Masuyama, N., Graves, J. D., and Gotoh, Y. (2001) Caspase Cleavage of MST1 Promotes Nuclear Translocation and Chromatin Condensation. Proc Natl Acad Sci U S A. 98, 10148-10153.

  9. Dong, Y., Du, X., Ye, J., Han, M., Xu, T., Zhuang, Y., and Tao, W. (2009) A Cell-Intrinsic Role for Mst1 in Regulating Thymocyte Egress. J Immunol. 183, 3865-3872.

  10. Mou, F., Praskova, M., Xia, F., Van Buren, D., Hock, H., Avruch, J., and Zhou, D. (2012) The Mst1 and Mst2 Kinases Control Activation of Rho Family GTPases and Thymic Egress of Mature Thymocytes. J Exp Med. 209, 741-759.

  11. von Gise, A., Lin, Z., Schlegelmilch, K., Honor, L. B., Pan, G. M., Buck, J. N., Ma, Q., Ishiwata, T., Zhou, B., Camargo, F. D., and Pu, W. T. (2012) YAP1, the Nuclear Target of Hippo Signaling, Stimulates Heart Growth through Cardiomyocyte Proliferation but Not Hypertrophy. Proc Natl Acad Sci U S A. 109, 2394-2399.

  12. Yamamoto, S., Yang, G., Zablocki, D., Liu, J., Hong, C., Kim, S. J., Soler, S., Odashima, M., Thaisz, J., Yehia, G., Molina, C. A., Yatani, A., Vatner, D. E., Vatner, S. F., and Sadoshima, J. (2003) Activation of Mst1 Causes Dilated Cardiomyopathy by Stimulating Apoptosis without Compensatory Ventricular Myocyte Hypertrophy. J Clin Invest. 111, 1463-1474.

  13. Lu, L., Li, Y., Kim, S. M., Bossuyt, W., Liu, P., Qiu, Q., Wang, Y., Halder, G., Finegold, M. J., Lee, J. S., and Johnson, R. L. (2010) Hippo Signaling is a Potent in Vivo Growth and Tumor Suppressor Pathway in the Mammalian Liver. Proc Natl Acad Sci U S A. 107, 1437-1442.

  14. Zhou, D., Zhang, Y., Wu, H., Barry, E., Yin, Y., Lawrence, E., Dawson, D., Willis, J. E., Markowitz, S. D., Camargo, F. D., and Avruch, J. (2011) Mst1 and Mst2 Protein Kinases Restrain Intestinal Stem Cell Proliferation and Colonic Tumorigenesis by Inhibition of Yes-Associated Protein (Yap) Overabundance. Proc Natl Acad Sci U S A. 108, E1312-20.

  15. Chung, C., Kim, T., Kim, M., Kim, M., Song, H., Kim, T. S., Seo, E., Lee, S. H., Kim, H., Kim, S. K., Yoo, G., Lee, D. H., Hwang, D. S., Kinashi, T., Kim, J. M., and Lim, D. S. (2013) Hippo-Foxa2 Signaling Pathway Plays a Role in Peripheral Lung Maturation and Surfactant Homeostasis. Proc Natl Acad Sci U S A. 110, 7732-7737.

  16. Chen, S., Fang, Y., Xu, S., Reis, C., and Zhang, J. (2018) Mammalian Sterile20-Like Kinases: Signalings and Roles in Central Nervous System. Aging Dis. 9, 537-552.

  17. Boggiano, J. C., Vanderzalm, P. J., and Fehon, R. G. (2011) Tao-1 Phosphorylates Hippo/MST Kinases to Regulate the Hippo-Salvador-Warts Tumor Suppressor Pathway. Dev Cell. 21, 888-895.

  18. Yin, F., Yu, J., Zheng, Y., Chen, Q., Zhang, N., and Pan, D. (2013) Spatial Organization of Hippo Signaling at the Plasma Membrane Mediated by the Tumor Suppressor Merlin/NF2. Cell. 154, 1342-1355.

  19. Meng, Z., Moroishi, T., and Guan, K. L. (2016) Mechanisms of Hippo Pathway Regulation. Genes Dev. 30, 1-17.

  20. Hong, L., Li, X., Zhou, D., Geng, J., and Chen, L. (2018) Role of Hippo Signaling in Regulating Immunity. Cell Mol Immunol. .

  21. Densham, R. M., O'Neill, E., Munro, J., Konig, I., Anderson, K., Kolch, W., and Olson, M. F. (2009) MST Kinases Monitor Actin Cytoskeletal Integrity and Signal Via c-Jun N-Terminal Kinase Stress-Activated Kinase to Regulate p21Waf1/Cip1 Stability. Mol Cell Biol. 29, 6380-6390.

  22. Lehtinen, M. K., Yuan, Z., Boag, P. R., Yang, Y., Villen, J., Becker, E. B., DiBacco, S., de la Iglesia, N., Gygi, S., Blackwell, T. K., and Bonni, A. (2006) A Conserved MST-FOXO Signaling Pathway Mediates Oxidative-Stress Responses and Extends Life Span. Cell. 125, 987-1001.

  23. Valis, K., Prochazka, L., Boura, E., Chladova, J., Obsil, T., Rohlena, J., Truksa, J., Dong, L. F., Ralph, S. J., and Neuzil, J. (2011) Hippo/Mst1 Stimulates Transcription of the Proapoptotic Mediator NOXA in a FoxO1-Dependent Manner. Cancer Res. 71, 946-954.

  24. Choi, J., Oh, S., Lee, D., Oh, H. J., Park, J. Y., Lee, S. B., and Lim, D. S. (2009) Mst1-FoxO Signaling Protects Naive T Lymphocytes from Cellular Oxidative Stress in Mice. PLoS One. 4, e8011.

  25. Cheung, W. L., Ajiro, K., Samejima, K., Kloc, M., Cheung, P., Mizzen, C. A., Beeser, A., Etkin, L. D., Chernoff, J., Earnshaw, W. C., and Allis, C. D. (2003) Apoptotic Phosphorylation of Histone H2B is Mediated by Mammalian Sterile Twenty Kinase. Cell. 113, 507-517.

  26. Wen, W., Zhu, F., Zhang, J., Keum, Y. S., Zykova, T., Yao, K., Peng, C., Zheng, D., Cho, Y. Y., Ma, W. Y., Bode, A. M., and Dong, Z. (2010) MST1 Promotes Apoptosis through Phosphorylation of Histone H2AX. J Biol Chem. 285, 39108-39116.

  27. Nehme, N. T., Pachlopnik Schmid, J., Debeurme, F., Andre-Schmutz, I., Lim, A., Nitschke, P., Rieux-Laucat, F., Lutz, P., Picard, C., Mahlaoui, N., Fischer, A., and de Saint Basile, G. (2012) MST1 Mutations in Autosomal Recessive Primary Immunodeficiency Characterized by Defective Naive T-Cell Survival. Blood. 119, 3458-3468.

  28. Abdollahpour, H., Appaswamy, G., Kotlarz, D., Diestelhorst, J., Beier, R., Schaffer, A. A., Gertz, E. M., Schambach, A., Kreipe, H. H., Pfeifer, D., Engelhardt, K. R., Rezaei, N., Grimbacher, B., Lohrmann, S., Sherkat, R., and Klein, C. (2012) The Phenotype of Human STK4 Deficiency. Blood. 119, 3450-3457.

  29. Oh, S., Lee, D., Kim, T., Kim, T. S., Oh, H. J., Hwang, C. Y., Kong, Y. Y., Kwon, K. S., and Lim, D. S. (2009) Crucial Role for Mst1 and Mst2 Kinases in Early Embryonic Development of the Mouse. Mol Cell Biol. 29, 6309-6320.

  30. Zhou, D., Medoff, B. D., Chen, L., Li, L., Zhang, X. F., Praskova, M., Liu, M., Landry, A., Blumberg, R. S., Boussiotis, V. A., Xavier, R., and Avruch, J. (2008) The Nore1B/Mst1 Complex Restrains Antigen Receptor-Induced Proliferation of Naive T Cells. Proc Natl Acad Sci U S A. 105, 20321-20326.

  31. Ueda, Y., Katagiri, K., Tomiyama, T., Yasuda, K., Habiro, K., Katakai, T., Ikehara, S., Matsumoto, M., and Kinashi, T. (2012) Mst1 Regulates Integrin-Dependent Thymocyte Trafficking and Antigen Recognition in the Thymus. Nat Commun. 3, 1098.