Phenotypic Mutation 'hardy' (pdf version)
Allelehardy
Mutation Type missense
Chromosome7
Coordinate55,945,208 bp (GRCm39)
Base Change T ⇒ C (forward strand)
Gene Oca2
Gene Name oculocutaneous albinism II
Synonym(s) p, D7H15S12, D7H15S12
Chromosomal Location 55,889,508-56,186,266 bp (+) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021879; MGI:97454

MappedYes 
Amino Acid Change Valine changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032633] [ENSMUSP00000119529] [ENSMUSP00000119099]
AlphaFold Q62052
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: V272A

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect possibly damaging

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000032633)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450
AA Change: V272A

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000152693)
Meta Mutation Damage Score 0.8109 question?
Is this an essential gene? Probably nonessential (E-score: 0.106) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(90) : Chemically and radiation induced(3) Chemically induced (ENU)(12) Chemically induced (other)(1) Gene trapped(1) Radiation induced(49) Spontaneous(20) Targeted(3) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 55930594 missense probably damaging 0.99
IGL01022:Oca2 APN 7 55974504 missense probably damaging 1.00
IGL01666:Oca2 APN 7 55964559 splice site probably null
IGL02157:Oca2 APN 7 55974545 splice site probably null
IGL02213:Oca2 APN 7 55971232 splice site probably benign
IGL02314:Oca2 APN 7 56006899 missense probably benign 0.00
IGL03083:Oca2 APN 7 55945232 missense probably benign 0.28
IGL03356:Oca2 APN 7 56185716 missense probably benign 0.01
charbon UTSW 7 55966153 missense probably damaging 1.00
cotton UTSW 7 56185716 missense probably benign 0.00
cutworm UTSW 7 55966168 missense probably damaging 1.00
Dirk UTSW 7 56185716 missense probably benign 0.00
draco1 UTSW 7 56073100 missense probably benign 0.00
faded UTSW 7 55974409 missense probably benign 0.19
narwhal UTSW 7 55945246 nonsense probably null
quicksilver UTSW 7 55974409 missense probably benign 0.19
renesmee UTSW 7 56185716 missense probably benign 0.00
slush UTSW 7 55927189 critical splice donor site probably null
snowflake UTSW 7 55974428 missense probably damaging 1.00
whitemouse UTSW 7 56064179 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56073100 missense probably benign 0.00
R1067:Oca2 UTSW 7 55966141 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56185716 missense probably benign 0.00
R1372:Oca2 UTSW 7 56185716 missense probably benign 0.00
R1457:Oca2 UTSW 7 55971269 missense probably damaging 1.00
R1737:Oca2 UTSW 7 55978533 missense probably damaging 1.00
R1802:Oca2 UTSW 7 55904728 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 55971246 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56064215 missense probably damaging 0.99
R2082:Oca2 UTSW 7 55946885 missense probably benign 0.01
R2229:Oca2 UTSW 7 56006903 missense probably benign 0.11
R4120:Oca2 UTSW 7 55904630 missense probably damaging 1.00
R4192:Oca2 UTSW 7 55946997 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56064182 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 55978560 missense probably benign 0.44
R4701:Oca2 UTSW 7 55904750 missense probably benign 0.00
R4887:Oca2 UTSW 7 55980106 nonsense probably null
R5053:Oca2 UTSW 7 55973328 missense probably benign 0.02
R5215:Oca2 UTSW 7 55945246 nonsense probably null
R5430:Oca2 UTSW 7 55945208 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56064210 missense probably damaging 1.00
R6416:Oca2 UTSW 7 55978515 missense probably benign 0.44
R6645:Oca2 UTSW 7 55964522 missense probably benign 0.21
R7257:Oca2 UTSW 7 55929286 intron probably benign
R7409:Oca2 UTSW 7 56064145 missense probably benign 0.00
R7530:Oca2 UTSW 7 55981720 missense probably damaging 0.99
R7820:Oca2 UTSW 7 55981713 missense probably damaging 1.00
R9043:Oca2 UTSW 7 55927189 critical splice donor site probably null
R9153:Oca2 UTSW 7 55943586 missense probably benign 0.00
R9205:Oca2 UTSW 7 55966168 missense probably damaging 1.00
R9681:Oca2 UTSW 7 55943623 missense probably null 1.00
Z1088:Oca2 UTSW 7 55980123 missense probably null 0.83
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2019-09-04 9:40 PM by Emre Turer
Record Created 2017-04-06 7:23 AM by Carlos Reyna
Record Posted 2018-02-22
Phenotypic Description
Figure 1. Hardy mice exhibited light gray coats (right). A C57BL/6J wild-type littermate is shown (left) for reference.

Figure 2. Hardy mice exhibited susceptibility to dextran sulfate sodium (DSS)-induced colitis at day 7 post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The hardy phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R5430, some of which exhibited a light gray coat (Figure 1).  Some mice also showed susceptibility to dextran sulfate sodium (DSS)-induced colitis at day 7 post-DSS treatment (Figure 2).
Nature of Mutation

Figure 3. Linkage mapping of the hypopigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R5430. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. Both of the above phenotypes were linked to two mutations on chromosome 7: Syt3 and Oca2. The mutation in Oca2 was presumed causative as the hardy hypopigmentation phenotype mimics other known alleles of Oca2 (see MGI for a list of Oca2 alleles as well as the Beutler Oca2 alleles: quicksilver, faded, charbon, draco1, snowflake, and whitemouse). The Oca2 mutation in hardy is a T to C transition at base pair 56,295,460 (v38) on chromosome 7, or base pair 55,868 in the GenBank genomic region NC_000073 encoding Oca2. The strongest association was found with a recessive model of inheritance to the pigmentation phenotype (P = 1.62 x 10-6), wherein five affected mice were homozygous for the variant allele, and 31 unaffected mice were either heterozygous (N = 14) or homozygous for the reference allele (N = 17) (Figure 3).

The mutation corresponds to residue 945 in the NM_021879 mRNA sequence in exon 8 of 24 total exons. 

929 ACCTACAATTGGACTGTCCTTTTAAATCCAAGA
267 -T--Y--N--W--T--V--L--L--N--P--R-
 

 

The mutated nucleotide is indicated in red. The mutation results in a valine to alanine substitution at residue 272 in the OCA2 protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain organization and function of the OCA2 protein. A, Topography. B, Domain structure. The hardy mutation results in a valine to alanine change at amino acid 272 in the mouse OCA2 protein. Other mutations found in OCA2  are noted in red. This image is interactive. Click on the mutations for more specific information.

OCA2 is a 110-kDa twelve transmembrane-spanning protein that exhibits homology to a number of bacterial transporters (1). The exact function of OCA2 in melanocytes is unknown. The hardy mutation occurs in the loop between the first and second transmembrane domains of the OCA2 protein. Protein expression and localization of OCA2 has not been examined in the draco1 mice.

Please see the record quicksilver for information about Oca2.

Putative Mechanism

Mutations in Oca2 are known to cause a variable reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (2;3). For example, mice with null alleles of Oca2 have very little to no eumelanin in their coat and eyes, resulting in a hypopigmentation phenotype: light grey fur with pink eyes on a nonagouti background (e.g., C57BL/6J), and cream-colored mice on an agouti background (4;5). The null mice have a reduced number of very small eumelanosomes in pigmented tissue with a concomitant decrease in the expression levels of melanosomal proteins (e.g., tyrosinase; see the record for ghost). The light coat color of hardy mice suggests a reduced function of the OCA2 protein in these animals.

Primers PCR Primer
hardy_pcr_F: ATCAGTTGGCATTCCTCACC
hardy_pcr_R: CCGGTGCCAAGATGTTGTTG

Sequencing Primer
hardy_seq_F: CCACAGGTTCTACATTCAAGGATTAG
hardy_seq_R: GTGCTATCAGACTTCTCCAGAAACTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 403 nucleotides is amplified (chromosome 7, + strand):


1   atcagttggc attcctcacc cacaggttct acattcaagg attagatcaa ctttcatttg
61  agaatatttg ttagagactg tgtctatact gactatgtac ccctgtgtta catggtggct
121 attcccaaag actgactgtc attttacatt ttggcttcta cagctcacct acaattggac
181 tgtcctttta aatccaagaa gtgagcacgt ggtggtgagc agaacctttg agatagtgag
241 caggtgggtt ttggggtttt gtacattttt ttctgggtaa ggcttaccgt cttcagccta
301 ccttcttctg gtatattaga ctatccaaga ctgagtgatt tataaggaat aacagtttct
361 ggagaagtct gatagcacag ggccaacaac atcttggcac cgg


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler