Phenotypic Mutation 'bonsai' (pdf version)
Allelebonsai
Mutation Type missense
Chromosome6
Coordinate125,312,770 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Ltbr
Gene Name lymphotoxin B receptor
Synonym(s) TNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar
Chromosomal Location 125,306,571-125,313,885 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010736; MGI:104875

Mapped Yes 
Limits of the Critical Region 125306571 - 125313885 bp
Amino Acid Change Threonine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000032489]
SMART Domains Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339
AA Change: T154S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
TNFR 43 80 5.73e-5 SMART
TNFR 83 124 3.96e-8 SMART
Blast:TNFR 126 169 3e-7 BLAST
TNFR 172 212 1.95e-7 SMART
transmembrane domain 222 244 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 362 388 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000032489)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS NK T cells - increased
fasting hyperglycemia (female)
growth/size
NK cell response - decreased
NK killing - decreased
Penetrance  
Alleles Listed at MGI

All alleles(7) : Chemically induced (ENU)(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Ltbr APN 6 125312366 missense probably damaging 0.96
armitage UTSW 6 125312794 missense probably damaging 0.97
kama UTSW 6 125313388 critical splice donor site probably null
marine_blue UTSW 6 125312808 missense probably damaging 0.98
R0090:Ltbr UTSW 6 125309449 splice site probably benign
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0553:Ltbr UTSW 6 125313388 critical splice donor site probably null
R0686:Ltbr UTSW 6 125308061 missense possibly damaging 0.88
R0879:Ltbr UTSW 6 125313375 splice site probably benign
R1086:Ltbr UTSW 6 125312740 splice site probably benign
R2118:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2120:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2122:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2124:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2199:Ltbr UTSW 6 125312061 missense probably benign 0.25
R4931:Ltbr UTSW 6 125307474 splice site probably null
R5051:Ltbr UTSW 6 125312770 missense probably damaging 1.00
R5174:Ltbr UTSW 6 125309537 missense probably benign 0.00
R5268:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5269:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5357:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5358:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5360:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5361:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5363:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5434:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5436:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5441:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5442:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5533:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5534:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5859:Ltbr UTSW 6 125312808 missense probably damaging 0.98
R6217:Ltbr UTSW 6 125307454 missense probably damaging 1.00
R6702:Ltbr UTSW 6 125308068 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-04-02 10:01 PM by Diantha La Vine
Record Created 2017-04-06 11:42 AM by Evan Nair-Gill
Record Posted 2018-02-22
Phenotypic Description

Figure 1. Bonsai mice exhibit increased frequencies of peripheral NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Bonsai mice exhibit reduced killing of beta-2-microglobulin-deficient NK cell targets.  Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The bonsai phenotype was initially identified among G3 mice of the pedigree R5051, some of which exhibited increased frequencies of natural killer (NK) T cells (Figure 1) and reduced killing of beta-2-microglobulin-deficient NK cell targets compared to wild-type littermates (Figure 2).

 

Nature of Mutation

Figure 3. Linkage mapping of reduced killing of beta-2-microglobulin-deficient NK cell targets using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 55 mutations (X-axis) identified in the G1 male of pedigree R5051. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Ltbr:  an A to T transversion at base pair 125,312,770 on chromosome 6, corresponding to base pair 1,101 in GenBank genomic region NC_000072 encoding Ltbr. The strongest association was found with a recessive model of inheritance to the NK cell effector response phenotype, wherein seven variant homozygotes departed phenotypically from 16 homozygous reference mice and 19 heterozygous mice with a P value of 9.346 x 10-7(Figure 3). 

 

The mutation corresponds to residue 660 in the mRNA sequence NM_010736 within exon 4 of 10 total exons.


 

645 CTCTGCCAGCCTGGCACAGAAGCCGAGGTCACA

149 -L--C--Q--P--G--T--E--A--E--V--T-

 

The mutated nucleotide is indicated in red.  The mutation results in a threonine to serine substitution at position 154 (T154S) in the LTβR protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 4. Domain structure of LTβR. The bonsai mutation within CRD3 is shown. Abbreviations: SP, signal peptide; CRD, cysteine-rich domain; TMD, transmembrane domain; SAD, self-association domain; TRAF, tumor necrosis factor receptor-associated factor; ECD, extracellular domain; ICD, intracellular domain. really interesting new gene; ZINC, zinc finger motifs; CC, coiled coil; MATH, meprin and TRAF homology. This image is interactive. Other mutations found in LTβR are noted in red. Click on the mutations for more information.

Ltbr encodes the lymphotoxin β receptor (LTβR), a member of the tumor necrosis factor receptor (TNFR) superfamily (1). Similar to other members of the TNFR family, LTβR has an extracellular domain (ECD; amino acids 28-221; SMART), a transmembrane domain (TMD; amino acids 222-244), and an intracellular domain (ICD; amino acis 245-415) (Figure 4) [(2); reviewed in (3)]. Amino acids 1-27 of LTβR comprise a signal peptide (2). LTβR has two conserved putative Asn-linked glycosylation sites at Asn40 and Asn179 (2). Within the ECD, LTβR has four cysteine-rich domains (CRDs; amino acids 43-80, 83-124, 126-169, and 172-212) [(4); reviewed in (3)]. The CRDs mediate ligand (i.e., LTα1β2 and LIGHT) specificity and affinity [(5;6); reviewed in (3)]. The second and third CRDs (i.e., amino acids 83-124 and 126-169) mediate most receptor-ligand interactions (6). The self-association domain (SAD; amino acids 324-377) within the ICD is required for LTβR-associated apoptotic signaling as well as for the association of LTβR with the serine/threonine kinases p50 and p80 (1;7). The bonsai mutation results in a threonine to serine substitution at position 154 in the LTβR protein; amino acid 154 is within the third CRD within the ECD.

 

For more information about Ltbr see the record for kama.

Putative Mechanism

LTα1β2 and LIGHT (alternatively, TNF superfamily (TNFSF)14) are the known ligands of LTβR; both LTα1β2 and LIGHT are members of the TNF superfamily [4;8-12); see the record PanR1 (Tnf) and walla (Cd40lg)]. LTα1β2 is expressed on activated T and B lymphocytes as well as natural killer (NK) cells, a subset of follicular B cells, and lymphoid tissue inducer (LTi) cells (CD4+IL-7R+CD3 CD45+RORγt+; see the record for chestnut) (9;13;14). LIGHT is a homotrimer expressed on T lymphocytes, monocytes, granulocytes, and immature dendritic cells (13).

 

LTβR signals through both the canonical (classical; see the record for finlay) and non-canonical (alternative; see the record for xander) nuclear factor κB (NF-κB) signaling pathways [(15-17); reviewed in (18)]. LTβR-mediated activation of the NF-κB signaling pathways results in the expression of genes that encode adhesion molecules, chemokines (e.g., CCL21 and CXCL13), and lymphokines involved in inflammation and secondary lymphoid organogenesis and homeostasis [(16); reviewed in (3)]. For a detailed review on the NF-κB signaling pathways see the records for finlay and xander.

 

LTβR-associated signaling mediates several functions including lymphoid tissue development and maintenance (19-23), formation of germinal centers (24), dendritic cell-mediated immune function (25;26), apoptosis (27), chemokine secretion, maintenance of splenic architecture, maintenance of T and B cell segregation into discrete compartments, protection against autoimmune diseases, regulation of lipid metabolism (28), homeostasis of the intestinal immune system (16) including protection against Citrobacter rodentium-induced colitis (10;29) and DSS-induced colitis (30) as well as protection against Mycbacterium bovis bacillus Calmette-Guérin (BCG), Mycobacterium tuberculosis, Listeria monocytogenes, and cytomegalovirus infections (31-33).

 

LTβR-associated signaling has been linked to several human conditions including autoimmunity, atherosclerosis, and cancer (see descriptions, above). Mutations in LTBR have been linked to increased risk for IgA nephropathy (OMIM: %161950), a form of glomerulonephritis that leads to end-stage renal disease, in Korean children (34).

 

Ltbr knockout (Ltbr-/-; Ltbrtm1Kpf, MGI:2384140) mice appear healthy, are born at the expected Menelian frequency, and are fertile (22). Ltbr-/- mice exhibited defects in secondary lymphoid organogenesis including the absence of cervical, axillary, inguinal, paraaortic/sacral, popliteal, and mesenteric lymph nodes, Peyer’s patches, and germinal centers, disorganization of the splenic architecture (i.e., disturbed microarchitecture of the white pulp, no separate B- and T-cell areas, no follicles, and disruptions to the marginal zone), and disruption of the thymic stroma architecture (21;22;35;36). All of the Ltbr-/- mice had a spleen and a thymus; the spleens of the Ltbr-/- mice were 1.5 to 2 times bigger than those in wild-type mice (22). Thymocyte maturation was normal in the Ltbr-/- mice (22). Within the spleen, the marginal zone B cell population (B220+, IgMhigh, IgDdull), MOMA-1+ metallophilic macrophages, sialoadhesin+ MZ macrophages, and MAdCAM-1+ sinus lining cells were completely undetectable (22). Flow cytometric analysis of lymphocytes from lungs and spleens of the Ltbr-/- mice determined that αEβ7high integrin+ T cells were absent (22). Infiltrations of lymphocytes (mainly CD4+ T cells and B220+ B cells) were observed in the Ltbr-/- mice around the perivascular areas in the lungs, liver, pancreas, submandibular glands, the fatty tissue of the mediastinum, mesenterium, cortex of the suprarenal glands, and kidney (22). Ltbr-/- mice exhibited lethality three weeks after exposure to Plasmodium berghei ANKA (PbA)-induced experimental cerebral malaria (ECM) with a concomitant high parasitaemia and severe anemia; wild-type mice succumb after approximately one week (37). Ltbr-/- mice did not develop ECM-associated neurological signs such as postural disorders, ataxia, impaired reflexes, loss of grip strength, progressive paralysis, and coma (37).  

 

LTβR-associated signaling is known to maintain the marginal zone to promote antibody responses and is required for the formation of germinal centers during antigen-dependent responses (16;22;38-41). Ltbr-/- mice exhibited higher levels of IgM in response to the T-dependent antigen, NP19-CG (4-hydroxy-3-nitrophenyl-acetyl-chicken gamma globulin absorbed to alum) compared to wild-type mice, however the amount of anti-NP IgG1 levels produced were lower than wild-type mice (22)

Primers PCR Primer
bonsai(F):5'- ACCAGTTCATGTCTTGGCAG -3'
bonsai(R):5'- TGCATGATGGGTACGACTG -3'

Sequencing Primer
bonsai_seq(F):5'- AGACCCCCTCCTGTGAGC -3'
bonsai_seq(R):5'- TACGACTGGGAGGGCCAG -3'
References

Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsEvan Nair-Gill, Bruce Beutler