Phenotypic Mutation 'gogi'

• Allele: gogi
• Mutation Type: critical splice donor site
• Chromosome: 13
• Coordinate: 95,015,217 bp (GRCm38)
• Base Change: T ⇒ A (forward strand)
• Gene: Wdr41
• Gene Name: WD repeat domain 41
• Synonym(s): B830029I03Rik, MSTP048
• Chromosomal Location: 94,976,344-95,023,314 bp (+)
• MGI Phenotype: FUNCTION: This gene encodes a protein of unknown function, but which contains a WD40 domain consisting of six WD40 repeats. The WD40 domain is one of the most abundant protein domains in eukaryotes, and is found in proteins with widely varying cellular functions. However, proteins with this domain often provide a rigid scaffold for protein-protein interactions. [provided by RefSeq, Aug 2012]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000055145 ^†] [ENSMUSP00000138501] [ENSMUSP00000138543] [ENSMUSP00000124033 ^†] [ENSMUSP00000129595] [ENSMUSP00000152667] † probably from a misspliced transcript
• AlphaFold: Q3UDP0
• SMART Domains: Protein: ENSMUSP00000055145; Gene: ENSMUSG00000042015

Domain	Start	End	E-Value	Type
WD40	32	70	4.48e-2	SMART
WD40	73	119	1.24e-4	SMART
WD40	122	159	1.28e1	SMART
WD40	211	249	2.86e0	SMART
WD40	308	350	7.92e-3	SMART
WD40	394	432	1.67e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000138501; Gene: ENSMUSG00000042015

Domain	Start	End	E-Value	Type
WD40	32	70	4.48e-2	SMART
WD40	73	119	1.24e-4	SMART
WD40	122	159	1.28e1	SMART
Blast:WD40	162	199	9e-6	BLAST
internal_repeat_1	233	260	6.23e-8	PROSPERO
internal_repeat_1	269	309	6.23e-8	PROSPERO

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000138543; Gene: ENSMUSG00000042015

Domain	Start	End	E-Value	Type
WD40	32	70	4.48e-2	SMART
WD40	73	119	1.24e-4	SMART
WD40	122	159	1.28e1	SMART
Blast:WD40	162	199	1e-5	BLAST
internal_repeat_2	224	281	1.46e-11	PROSPERO
internal_repeat_1	233	315	2.35e-20	PROSPERO
internal_repeat_2	306	365	1.46e-11	PROSPERO
internal_repeat_1	353	435	2.35e-20	PROSPERO

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000138569; Gene: ENSMUSG00000042015

Domain	Start	End	E-Value	Type
internal_repeat_2	1	37	2.8e-14	PROSPERO
internal_repeat_1	2	42	7.42e-17	PROSPERO
internal_repeat_1	38	78	7.42e-17	PROSPERO
internal_repeat_2	43	79	2.8e-14	PROSPERO

• Predicted Effect: noncoding transcript
• SMART Domains: Protein: ENSMUSP00000124033; Gene: ENSMUSG00000042015

Domain	Start	End	E-Value	Type
WD40	32	70	4.48e-2	SMART
WD40	73	119	1.24e-4	SMART
WD40	122	159	1.28e1	SMART
WD40	211	249	2.86e0	SMART
WD40	308	350	7.92e-3	SMART
WD40	394	432	1.67e-1	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000129595; Gene: ENSMUSG00000042015

Domain	Start	End	E-Value	Type
WD40	32	70	4.48e-2	SMART
WD40	73	119	1.24e-4	SMART
WD40	122	159	1.28e1	SMART
Blast:WD40	162	199	9e-6	BLAST
internal_repeat_1	233	260	6.23e-8	PROSPERO
internal_repeat_1	269	309	6.23e-8	PROSPERO

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9592
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2017-04-11 2:41 PM
• Record Posted: 2019-01-09
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, William McAlpine, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_172590; MGI:2445123

Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (other)(1) Gene trapped(2) Targeted(2)

Phenotypic Description

Figure 1. Gogi mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Gogi mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Gogi mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Gogi mice exhibit increased frequencies of peripheral B1a cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Gogi mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Gogi mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Gogi mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Gogi mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Gogi mice exhibit reduced expression of IgM on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Gogi mice exhibit increased expression of B220 on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Gogi mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Gogi mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Gogi mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. WDR41 mice show increased TNFα secretion in response to endosomal TLR stimulation . ELISA analysis of TNF secretion by peritoneal macrophages (n = 4 mice per genotype) stimulated for 6 h with indicated concentrations of poly(I:C), R848, and CpG. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Figure and legend modified from ( 1 ).

Figure 15. Gogi mice exhibited sensitivity to dextran sodium sulfate (DSS)-induced colitis on day 7 after DSS treatment . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Gogi mice exhibited sensitivity to dextran sodium sulfate (DSS)-induced colitis on day 10 after DSS treatment . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The gogi phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5055, some of which showed reduced frequencies of B2 cells (Figure 1), naive CD4 T cells in CD4 T cells (Figure 2), and naive CD8 T cells in CD8 T cells (Figure 3) with concomitant increased frequencies of B1a cells (Figure 4), B1b cells (Figure 5), CD44+ CD4 T cells (Figure 6), effector memory CD4 T cells in CD4 T cells (Figure 7), and effector memory CD8 T cells in CD8 T cells (Figure 8), all in the peripheral blood (1). Expression of IgM was reduced (Figure 9), while expression of B220 was increased (Figure 10) on peripheral blood B cells. Expression of CD44 was increased on peripheral blood T cells (Figure 11), CD4+ T cells (Figure 12), and CD8+ T cells (Figure 13). Peritoneal macrophages from the gogi mice showed elevated TNF production after stimulation with the TLR ligands poly(I:C), R848, and CpG (Figure 14) (1). Some mice showed sensitivity to dextran sodium sulfate (DSS)-induced colitis on days 7 (Figure 15) and 10 (Figure 16) after DSS treatment (1).

Nature of Mutation

Figure 17. Linkage mapping of increased effector memory CD8 T cells in CD8 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 82 mutations (X-axis) identified in the G1 male of pedigree R5055. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 82 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Wdr41:  a T to A transversion at base pair 95,015,217 (v38) on chromosome 13, or base pair 39,003 in the GenBank genomic region NC_000079 within the splice donor site of intron 10 (2-base pairs from exon 10). The strongest association was found with a recessive model of inheritance to the normalized frequency of effector memory CD8 T cells in CD8 T cells, wherein nine variant homozygotes departed phenotypically from 17 homozygous reference mice and 25 heterozygous mice with a P value of 5.241 x 10^-14 (Figure 17).  A substantial semidominant effect was observed in several of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic site in intron 10. The resulting transcript would have a 4-base pair insertion of intron 10, which would cause a frame shifted protein product beginning after amino acid 294 of the protein and premature termination after the inclusion of 14 aberrant amino acids.

C57BL/6J:           <--exon 9     <--exon 10 intron 10-->     exon 11-->         <--exon 14 880 ……GCTAACATCAATG ……TGCGATGAAGAG gtaggtagtataat…… AATATATTTGCT…… ……GAGTCCCCTTGA 1578 229 ……-A--N--I--N-- ……-C--D--E--E-                  -N--I--F--A-…… ……-E--S--P--*- 460

The donor splice site of intron 10, which is destroyed by the gogi mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 18. Domain organization of WDR41. WDR41 is a member of the WD repeat protein family and has six WD repeats.The gogi mutation destroys the donor splice site of intron 10. This image is interactive. Other mutations found in WDR41 are noted. Click on each mutation for more information.

Wdr41 encodes WDR41 (WD repeat-containing protein 41), a member of the WD repeat protein family. WDR41 has six WD repeats (Figure 18). WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes.

The gogi mutation is predicted to result in a 4-base pair insertion of intron 10, which would cause a frame shifted protein product beginning after amino acid 294 of the protein and premature termination after the inclusion of 14 aberrant amino acids.

Expression/Localization

Expression analysis for WDR41 has not been reported, but the protein localizes to lysosomes (2).

Background

Figure 19. Role of WDR41 in the autophagy. During autophagy, cytoplasmic proteins or organelles are engulfed into double-membrane vesicles called autophagosomes. The autophagosomes subsequently fuse with lysosomes to form autolysosomes, which are primed for degradation. SMCR8 regulates phagophore formation, autophagosome maturation, and lysosomal function. SMCR8 interacts with C9ORF72 and WDR41 to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex. After TBK1-mediated phosphorylation of SMCR8, the SWC complex promotes GDP exchange for RAB39B and subsequent interaction with the ULK1 autophagy initiation complex (ULK1/FIP200/autophagy-related protein 13 [ATG13]/ATG101). The SWC-ULK1 interaction mediates trafficking of the ULK1 complex to the phagophore. The interaction with RAB39B also putatively promotes the delivery of poly-ubiquitinated misfolded protein aggregates to the autophagosome. This image is interactive. Click on the image to view other mutations found in the pathway. Click on each mutation for more information.

Autophagy is a intracellular recycling and degradation process in which cytoplasmic proteins or organelles are engulfed into double-membrane vesicles called autophagosomes. The autophagosomes subsequently fuse with lysosomes to form autolysosomes, which are primed for degradation. Autophagy removes aggregates of misfolded proteins and defective organelles as well as provides energy and recycles cell components.

WDR41 interacts with C9ORF72 and SMCR8 (see the record for patriot) to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex (Figure 19) (3;4). The SWC complex functions as a GDP-GTP exchange factor for the small GTPases RAB8A and RAB39B, which function in vesicle trafficking and autophagy (4-8). After TBK1-mediated phosphorylation of SMCR8, the SWC complex interacts with the autophagy initiation complex ULK1/FIP200/autophagy-related protein 13 (ATG13)/ATG101 via C9ORF72 binding (4;5;7). The interaction between the SWC complex and the ULK1 complex regulates the expression and activity of ULK1 (7;8). Knockout of SMCR8 or C9ORF72 resulted in enlarged lysosome vesicles, while SMCR8 knockout alone showed accumulation of lysosomes and lysosomal enzymes as well as impaired autophagy induction (4-7;9). The function of WDR41 is unknown, but it is a putative scaffold protein that regulates the localization of C9orf72 and SMCR8 to the lysosome (2).

The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis (10). When there are sufficient nutrients, mTOR signaling is active allowing for protein synthesis and an increase in cell size (11-13). In contrast, when nutrient levels decrease or in conditions of cell stress, protein synthesis is inhibited with a concomitant decrease in cell size and cell proliferation (11;12). mTOR can be incorporated into both the mTORC1 and mTORC2 complex. mTORC1 signaling in response to changes in amino acid availability is a lysosome-dependent process. When mTORC1 is activated upon raptor binding to mTOR, it phosphorylates several targets, including S6 kinase 1 (S6K1) and 4E-binding protein 1 (4E-BP1) (14;15). S6K1, in addition to S6K2, is a kinase that phosphorylates S6, a component of the small (40S) ribosomal subunit (13). Autophagy is initiated upon inhibition of mTORC1, resulting in formation of an active ULK1 complex (16). WDR41 is required for mTORC1 activation by amino acids (2); WDR41 knockout cells showed impaired S6K phosphorylation.

Wdr41-deficient mice have not been generated/phenotypically characterized (MGI; accessed September 15, 2017).

Putative Mechanism

Figure 20. Overview of endosomal Toll-like receptor (TLR) signaling pathways. TLR3, 7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions. Signaling events downstream of TLR activation ultimately lead to the induction of thousands of genes including TNF and type I IFN. In the MyD88-dependent pathway, MyD88 (lime green) recruits IRAK kinases. TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, resulting in IκB ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus. Activation of TLR7 and 9 recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN. In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. TLR signaling initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7. The endosomal TLRs recognize exogenous nucleic acids:  double-stranded DNA unmethylated at CpG motifs (TLR9), single-stranded (ss) RNA viruses (TLR7 and TLR8) and double-stranded RNA (dsRNA; TLR3) (Figure 20). Plasmacytoid dendritic cell recognition of some ssRNA viruses via TLR7 requires the transport of cytosolic viral replication intermediates into lysosomes by autophagy (17), a process by which cells engulf parts of their own cytoplasm to eliminate foreign material or recycle various molecules. Proteolytic cleavage of TLR7 and TLR9 within their respective ectodomains occurs in the endolysosome (18;19). Although full length and cleaved forms of TLR9 are capable of binding ligand, only the cleaved form can recruit MyD88 and lead to signaling. The cleavage mechanism has been postulated to restrict receptor activation to endolysosomal compartments and prevent responses to self-nucleic acids (18). 
Once activated, TLR9 signaling requires the adapter MyD88 and, like other MyD88-dependent TLRs, recruits IL-1R-associated kinase 1 (IRAK1), IRAK4 and tumor necrosis factor receptor-associated factor 6 (TRAF6), leading to NF-κB and MAP kinase activation (20). MyD88, together with TRAF6 and IRAK4, has also been shown to bind interferon regulatory factor 7 (IRF7) directly in order to stimulate IFN-α production (21;22).

The defects in TLR9-associated signaling observed in the gogi mice is proposed to be caused by defects in the SWC complex due to loss of WDR41-assocated function (1). Loss of SWC complex function causes defects in lysosome and phagosome maturation, resulting in protracted TLR stimulation. The colitis phenotype observed in the gogi mice is putatively caused by defects in endosomal TLR signaling; the endosomal TLRs are required for protection in colitis.

Primers

PCR Primer
gogi_pcr_F: ACAGGTTTCGTCACTGGCTC
gogi_pcr_R: GCTCAAGGATGAAAGGGCTTTC

Sequencing Primer
gogi_seq_F: GTCACTGGCTCCCACGTTG
gogi_seq_R: CAATCTTTGTAAGTTTGTCAAGCC

Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

gogi_PCR_F: 5’- ACAGGTTTCGTCACTGGCTC-3’

gogi_PCR_R: 5’- GCTCAAGGATGAAAGGGCTTTC-3’

Sequencing Primers

gogi_SEQ_F: 5’- GTCACTGGCTCCCACGTTG-3’
 

gogi_SEQ_R: 5’- CAATCTTTGTAAGTTTGTCAAGCC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 621 nucleotides is amplified:

acaggtttcg tcactggctc ccacgttggc gagctgctca tctgggatgc cctggactgg       

actgtgcagg cctgtgagcg caccttctgg agcccgaccg cacagctgga tgcccagcag      

gaaataaagc tcttccaaaa acaaaatgat atttctatta atcatttcac atgcgatgaa      

gaggtaggta gtataattgt tgcaaataaa attagtatct ggtatttaaa gccttctata      

ttagatataa aaagttatga ttctgggttg ttgagagggc tcagtgtgca aaagcactta      

taactgaagt tcaatggaca ggatccatag ggtagagaga acacacacac acacatacac      

acacacacat acatccacac acacacacac atacacatcc acacacacat ccacacacac      

atgcacacat atacatacat acacacacac aaacacacac acacacacac acacacacac      

acacacacac acacacacat caaacactcc gaacaaaaag caatggaagg gttattacct      

atggtttcaa gttttaaaat ggcttgacaa acttacaaag attgtaccac tttttttttg      

aaagcccttt catccttgag c

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = T>A).

References

  1. McAlpine, W., Sun, L., Wang, K. W., Liu, A., Jain, R., San Miguel, M., Wang, J., Zhang, Z., Hayse, B., McAlpine, S. G., Choi, J. H., Zhong, X., Ludwig, S., Russell, J., Zhan, X., Choi, M., Li, X., Tang, M., Moresco, E. M. Y., Beutler, B., and Turer, E. (2018) Excessive Endosomal TLR Signaling Causes Inflammatory Disease in Mice with Defective SMCR8-WDR41-C9ORF72 Complex Function. Proc Natl Acad Sci U S A. 115, E11523-E11531.

  2. Amick, J., Tharkeshwar, A. K., Amaya, C., and Ferguson, S. M. (2018) WDR41 Supports Lysosomal Response to Changes in Amino Acid Availability. Mol Biol Cell. 29, 2213-2227.

  3. Zhang, Y., Burberry, A., Wang, J. Y., Sandoe, J., Ghosh, S., Udeshi, N. D., Svinkina, T., Mordes, D. A., Mok, J., Charlton, M., Li, Q. Z., Carr, S. A., and Eggan, K. (2018) The C9orf72-Interacting Protein Smcr8 is a Negative Regulator of Autoimmunity and Lysosomal Exocytosis. Genes Dev. 32, 929-943.

  4. Sullivan, P. M., Zhou, X., Robins, A. M., Paushter, D. H., Kim, D., Smolka, M. B., and Hu, F. (2016) The ALS/FTLD Associated Protein C9orf72 Associates with SMCR8 and WDR41 to Regulate the Autophagy-Lysosome Pathway. Acta Neuropathol Commun. 4, 51-016-0324-5.

  5. Sellier, C., Campanari, M. L., Julie Corbier, C., Gaucherot, A., Kolb-Cheynel, I., Oulad-Abdelghani, M., Ruffenach, F., Page, A., Ciura, S., Kabashi, E., and Charlet-Berguerand, N. (2016) Loss of C9ORF72 Impairs Autophagy and Synergizes with polyQ Ataxin-2 to Induce Motor Neuron Dysfunction and Cell Death. EMBO J. 35, 1276-1297.

  6. Amick, J., Roczniak-Ferguson, A., and Ferguson, S. M. (2016) C9orf72 Binds SMCR8, Localizes to Lysosomes, and Regulates mTORC1 Signaling. Mol Biol Cell. 27, 3040-3051.

  7. Yang, M., Liang, C., Swaminathan, K., Herrlinger, S., Lai, F., Shiekhattar, R., and Chen, J. F. (2016) A C9ORF72/SMCR8-Containing Complex Regulates ULK1 and Plays a Dual Role in Autophagy. Sci Adv. 2, e1601167.

  8. Jung, J., Nayak, A., Schaeffer, V., Starzetz, T., Kirsch, A. K., Muller, S., Dikic, I., Mittelbronn, M., and Behrends, C. (2017) Multiplex Image-Based Autophagy RNAi Screening Identifies SMCR8 as ULK1 Kinase Activity and Gene Expression Regulator. Elife. 6, 10.7554/eLife.23063.

  9. Ugolino, J., Ji, Y. J., Conchina, K., Chu, J., Nirujogi, R. S., Pandey, A., Brady, N. R., Hamacher-Brady, A., and Wang, J. (2016) Loss of C9orf72 Enhances Autophagic Activity Via Deregulated mTOR and TFEB Signaling. PLoS Genet. 12, e1006443.

  10. Baba, M., Hong, S. B., Sharma, N., Warren, M. B., Nickerson, M. L., Iwamatsu, A., Esposito, D., Gillette, W. K., Hopkins, R. F.,3rd, Hartley, J. L., Furihata, M., Oishi, S., Zhen, W., Burke, T. R.,Jr, Linehan, W. M., Schmidt, L. S., and Zbar, B. (2006) Folliculin Encoded by the BHD Gene Interacts with a Binding Protein, FNIP1, and AMPK, and is Involved in AMPK and mTOR Signaling. Proc Natl Acad Sci U S A. 103, 15552-15557.

  11. Fernandez, D., and Perl, A. (2010) MTOR Signaling: A Central Pathway to Pathogenesis in Systemic Lupus Erythematosus? Discov Med. 9, 173-178.

  12. Lee, D. F., and Hung, M. C. (2007) All Roads Lead to mTOR: Integrating Inflammation and Tumor Angiogenesis. Cell Cycle. 6, 3011-3014.

  13. Wang, X., and Proud, C. G. (2006) The mTOR Pathway in the Control of Protein Synthesis. Physiology (Bethesda). 21, 362-369.

  14. Mills, R. E., and Jameson, J. M. (2009) T Cell Dependence on mTOR Signaling. Cell Cycle. 8, 545-548.

  15. Hay, N., and Sonenberg, N. (2004) Upstream and Downstream of mTOR. Genes Dev. 18, 1926-1945.

  16. Kim, J., Kundu, M., Viollet, B., and Guan, K. L. (2011) AMPK and mTOR Regulate Autophagy through Direct Phosphorylation of Ulk1. Nat Cell Biol. 13, 132-141.

  17. Lee, H. K., Lund, J. M., Ramanathan, B., Mizushima, N., and Iwasaki, A. (2007) Autophagy-Dependent Viral Recognition by Plasmacytoid Dendritic Cells. Science. 315, 1398-1401.

  18. Ewald, S. E., Lee, B. L., Lau, L., Wickliffe, K. E., Shi, G. P., Chapman, H. A., and Barton, G. M. (2008) The Ectodomain of Toll-Like Receptor 9 is Cleaved to Generate a Functional Receptor. Nature. 456, 658-662.

  19. Park, B., Brinkmann, M. M., Spooner, E., Lee, C. C., Kim, Y. M., and Ploegh, H. L. (2008) Proteolytic Cleavage in an Endolysosomal Compartment is Required for Activation of Toll-Like Receptor 9. Nat Immunol. 9, 1407-1414.

  20. Hemmi, H., Kaisho, T., Takeuchi, O., Sato, S., Sanjo, H., Hoshino, K., Horiuchi, T., Tomizawa, H., Takeda, K., and Akira, S. (2002) Small Anti-Viral Compounds Activate Immune Cells Via the TLR7 MyD88- Dependent Signaling Pathway. Nat Immunol. 3, 196-200.

  21. Kawai, T., Sato, S., Ishii, K. J., Coban, C., Hemmi, H., Yamamoto, M., Terai, K., Matsuda, M., Inoue, J., Uematsu, S., Takeuchi, O., and Akira, S. (2004) Interferon-Alpha Induction through Toll-Like Receptors Involves a Direct Interaction of IRF7 with MyD88 and TRAF6. Nat Immunol. 5, 1061-1068.

  22. Honda, K., Yanai, H., Mizutani, T., Negishi, H., Shimada, N., Suzuki, N., Ohba, Y., Takaoka, A., Yeh, W. C., and Taniguchi, T. (2004) Role of a Transductional-Transcriptional Processor Complex Involving MyD88 and IRF-7 in Toll-Like Receptor Signaling. Proc Natl Acad Sci U S A. 101, 15416-15421.