Phenotypic Mutation 'porch2' (pdf version)
List |< first << previous [record 60 of 132] next >> last >|
Alleleporch2
Mutation Type nonsense
Chromosome14
Coordinate50,951,506 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Pnp
Gene Name purine-nucleoside phosphorylase
Synonym(s) Np, Np-1, Np-2, Pnp, Pnp1
Chromosomal Location 50,931,082-50,965,237 bp (+)
MGI Phenotype PHENOTYPE: Nullizygous mice show impaired thymocyte differentiation, T cell function and mitochondrial DNA repair, altered lymphocyte subpopulations and metabolism, and enhanced thymocyte apoptosis and sensitivity to gamma-irradiation. ENU-induced mutants show a gradual decline in T cell number and function. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013632; MGI:97365

Mapped Yes 
Amino Acid Change Leucine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000043926] [ENSMUSP00000093615] [ENSMUSP00000136557] [ENSMUSP00000154805] [ENSMUSP00000154171]
SMART Domains Protein: ENSMUSP00000043926
Gene: ENSMUSG00000115338
AA Change: L252*

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 5.2e-56 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338
AA Change: L252*

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably null
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1a cells in B1 cells - decreased
FACS B1b cells - increased
FACS B1b cells in B1 cells - increased
FACS B2 cells - decreased
FACS B220 MFI - increased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased 10859343
FACS CD4+ T cells in CD3+ T cells - decreased 10859343
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased
T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(6) Chemically induced (other)(1) Gene trapped(11) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Pnp APN 14 50951002 missense probably benign
IGL01824:Pnp APN 14 50951413 missense probably damaging 1.00
IGL02649:Pnp APN 14 50947846 splice site probably benign
IGL03148:Pnp APN 14 50950728 splice site probably benign
Porch UTSW 14 50950923 nonsense probably null
R0097:Pnp UTSW 14 50951416 missense probably damaging 1.00
R1510:Pnp UTSW 14 50950585 missense possibly damaging 0.80
R1823:Pnp UTSW 14 50950329 missense probably damaging 1.00
R1864:Pnp UTSW 14 50947973 missense probably benign 0.00
R3429:Pnp UTSW 14 50947986 missense probably benign 0.10
R4639:Pnp UTSW 14 50950923 nonsense probably null
R5078:Pnp UTSW 14 50951506 nonsense probably null
R5982:Pnp UTSW 14 50950543 missense probably damaging 1.00
R6431:Pnp UTSW 14 50951014 missense probably damaging 1.00
Z1088:Pnp UTSW 14 50951495 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-07-18 10:11 AM by Anne Murray
Record Created 2017-04-13 7:35 AM
Record Posted 2018-07-18
Phenotypic Description
Figure 1. Porch2 mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Porch2 mice exhibit decreased frequencies of peripheral B1 cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Porch2 mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Porch2 mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Porch2 mice exhibit increased frequencies of peripheral B1b cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Porch2 mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Porch2 mice exhibit a reduced CD4 to CD8 T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Porch2 mice exhibit reduced frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Porch2 mice exhibit reduced frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Porch2 mice exhibit reduced frequencies of peripheral naive CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Porch2 mice exhibit reduced frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Porch2 mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Porch2 mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Porch2 mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Porch2 mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Porch2 mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Porch2 mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Porch2 mice exhibit increased B220 expression on B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 19. Porch2 mice exhibit increased CD44 expression on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 20. Porch2 mice exhibit increased CD44 expression on CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 21. Porch2 mice exhibit increased CD44 expression on CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The porch2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5078, some of which showed a reduced frequency of T cells (Figure 1), B1a cells in B1 cells (Figure 2), and in B2 cells (Figure 3) with a concomitant increase in the frequency of B1b cells (Figure 4), B1b cells in B1 cells (Figure 5), and CD44+ T cells (Figure 6). Some mice showed a diminished CD4 to CD8 T cell ratio (Figure 7) due to reduced frequencies of CD4+ T cells (Figure 8), CD4+ T cells in CD3+ T cells (Figure 9), naïve CD4 T cells in CD4 T cells (Figure 10), and in naïve CD8 T cells in CD8 T cells (Figure 11) with a concomitant increased frequency of CD44+ CD8 T cells (Figure 12), CD8+ T cells in CD3+ T cells (Figure 13), central memory CD8 T cells in CD8 T cells (Figure 14), effector memory CD8 T cells in CD8 T cells (Figure 15), central memory CD4 T cells in CD4 T cells (Figure 16), and effector memory CD4 T cells in CD4 T cells (Figure 17), all in the peripheral blood. Some mice exhibited increased expression of B220 on B cells (Figure 18) as well as increased expression of CD44 on T cells (Figure 19), including CD4+ T cells (Figure 20) and CD8+ T cells (Figure 21), all in the peripheral blood.

Nature of Mutation

Figure 22. Linkage mapping of the increased frequency of effector memory CD4 T cells in CD4 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R5078. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

 

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. All of the above anomalies were linked to a mutation in Pnp: a T to A transversion at base pair 50,951,506 (v38) on chromosome 14, or base pair 7,204 in the GenBank genomic region NC_000080 encoding Pnp. The strongest association was found with a recessive model of inheritance to the increased frequency of effector memory CD4 T cells in CD4 T cells phenotype, wherein 1 variant homozygote departed phenotypically from 16 homozygous reference mice and 22 heterozygous mice with a P value of 2.416 x 10-13 (Figure 22).  

 

The mutation corresponds to residue 1,035 in the mRNA sequence NM_013632 within exon 5 of 6 total exons.

 

1019 ATGGATTATGAGAACTTGGAGAAGGCCAATCAC

247  -M--D--Y--E--N--L--E--K--A--N--H-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of leucine 252 for a premature stop codon (L252*) in the PNP protein.

Protein Prediction
Figure 23. Domain organization of PNP. The location of the porch2 mutation is indicated. Other mutations found in PNP are noted in red. Click on each mutation for more information.

Pnp encodes purine nucleoside phosphorylase (PNP). The crystal structure of human PNP has been solved [PDB:3D1V; (1)]. PNP is a homotrimer, and each PNP monomer displays an α-/β-fold consisting of a mixed β-sheet surrounded by α helices. PNP has an eight-stranded mixed β-sheet and a five-stranded mixed β-sheet, which join to form a distorted β-barrel. Seven α-helices surround the β-sheet structure. Tyr88, Phe141, Phe159, Phe200, and Leu209 are involved in the subunit interaction. Amino acids 241 to 260 act as a gate that opens during substrate binding and controls access to the active site. Gate opening occurs upon a helical transformation of residues 257 to 265.

 

The porch2 mutation results in substitution of leucine 252 for a premature stop codon (L252*) in the PNP protein (Figure 23). Amino acid 252 are within the region of PNP that acts as a gate.

 

Please see the record porch for more information about Pnp.

Putative Mechanism

PNP is an enzyme that functions in purine degradation and salvage. PNP catalyzes the reversible phosphorolysis of inosine, guanosine, deoxyinosine, and deoxyguanosine (dGuo) to their respective bases and ribose-1-phosphate sugar. Control of PNP substrates (and their phosphorylated products) is essential for cell signaling, energy production, and DNA formation. Accumulation of dGuo is toxic to lymphocytes (2;3).

 

Mutations in PNP are linked to immunodeficiency due to purine nucleoside phosphorylase deficiency (OMIM: #613179; (4-6)). Patients with immunodeficiency due to purine nucleoside phosphorylase deficiency exhibit reduced T cell function and some patients exhibit neurologic impairments such as spastic paresis. Patients can exhibit variable B-cell dysfuction. Patients with PNP deficiency have increased risk of autoimmune disorders, including hemolytic anemia, neutropenia, thyroiditis, and thrombocytopenia (7). Patients have normal serum immunoglobulin levels, but T-dependent antibody production is reduced [reviewed in (8)].

 

Mice homozygous for an ENU-induced mutant Pnp allele (Pnpbata/bata) exhibit reduced numbers of marginal zone B cells with concomitant increased numbers of T follicular helper cells (MGI). Proliferation of IL-17-stimulated bone marrow-derived B cells was diminished (MGI). Mice homozygous for other ENU-induced mutant Pnp alleles (Pnpe/e, Pnpf/f, and Pnpg/g) exhibited thymus hypoplasia, reduced numbers of double-positive T cells and CD8+ T cells in the spleen with concomitant increased numbers of double-negative T cells (9). The Pnpe/e, Pnpf/f, and Pnpg/g mice also had impaired spleen leukocyte responses to conA and IL-12 (9). The Pnpe/e and Pnpf/f mice also showed increased amounts of inosine and some guanosine excreted in the urine compared to wild-type controls (10). Pnp-deficient mice exhibited increased thymocyte apoptosis as well as increased double-negative T cell numbers and pre-B cells with concomitant reduced numbers of double-positive T cells, CD4+ T cells, and CD8+ T cells (2). The Pnp-deficient mice had high concentrations of purine nucleosides (inosine, deoxyinosine, guanosine, and deoxyguanosine) in the urine and deficient mitochondrial DNA repair (2).

 

Aberrant PNP activation results in the accumulation of dGTP, an imbalance of the deoxynucleoside triphosphate (dNTP) pools, and induces cell apoptosis. The phenotype of the porch2 indicates loss of PNPporch2 function.

Primers PCR Primer
porch2(F):5'- TAGCTAGTAAGGCTACCTGAGAG -3'
porch2(R):5'- TAGAGAGCTACTTGGACCCC -3'

Sequencing Primer
porch2_seq(F):5'- TGGATGCTTTCTGAAATTCAGTGAAC -3'
porch2_seq(R):5'- TACTTGGACCCCACCAGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong and Bruce Beutler
List |< first << previous [record 60 of 132] next >> last >|