Phenotypic Mutation 'andalusia3' (pdf version)
List |< first << previous [record 19 of 74] next >> last >|
Alleleandalusia3
Mutation Type critical splice donor site
Chromosome9
Coordinate111,229,838 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Mlh1
Gene Name mutL homolog 1
Synonym(s) colon cancer, nonpolyposis type 2, 1110035C23Rik
Chromosomal Location 111,228,228-111,271,791 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced pairing in meiotic prophase I and produce no mature germ cells. Mutants also display increased microsatellite instability and a predisposition for developing intestinal and other tumors. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_026810, NM_001324522; MGI:101938

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000035078] [ENSMUSP00000035079] [ENSMUSP00000095944] [ENSMUSP00000143786]
SMART Domains Protein: ENSMUSP00000035079
Gene: ENSMUSG00000032498

DomainStartEndE-ValueType
HATPase_c 23 158 4.57e-1 SMART
DNA_mis_repair 216 335 1.08e-44 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 429 454 N/A INTRINSIC
Pfam:Mlh1_C 504 760 8.3e-100 PFAM
Predicted Effect probably null
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
30 min GTT hyperglycemic (male)
FACS B:T cells - increased
FACS CD44+ CD8 MFI - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
T-dependent humoral response defect- decreased antibody response to rSFV
total IgE level - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(14) : Endonuclease-mediated(1) Gene trapped(6) Targeted(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Mlh1 APN 9 111252912 missense possibly damaging 0.84
IGL02530:Mlh1 APN 9 111229875 missense probably benign 0.09
IGL02811:Mlh1 APN 9 111271514 missense probably benign 0.04
IGL02892:Mlh1 APN 9 111252969 missense probably benign 0.00
IGL03394:Mlh1 APN 9 111268243 missense probably damaging 1.00
andalusia UTSW 9 111271410 missense probably null
andalusia2 UTSW 9 111271523 start codon destroyed probably null 0.93
ANU23:Mlh1 UTSW 9 111252912 missense possibly damaging 0.84
R0496:Mlh1 UTSW 9 111241556 missense probably benign
R0723:Mlh1 UTSW 9 111271472 missense probably damaging 1.00
R1395:Mlh1 UTSW 9 111247377 missense probably damaging 1.00
R1694:Mlh1 UTSW 9 111228475 missense probably damaging 1.00
R1762:Mlh1 UTSW 9 111229929 missense probably damaging 1.00
R1865:Mlh1 UTSW 9 111257024 intron probably benign
R1885:Mlh1 UTSW 9 111258556 missense probably benign 0.18
R1992:Mlh1 UTSW 9 111228563 missense probably damaging 0.96
R2186:Mlh1 UTSW 9 111258566 unclassified probably benign
R2680:Mlh1 UTSW 9 111236017 critical splice acceptor site probably null
R4693:Mlh1 UTSW 9 111255658 missense probably damaging 1.00
R4784:Mlh1 UTSW 9 111239798 missense probably benign
R5007:Mlh1 UTSW 9 111271410 makesense probably null
R5130:Mlh1 UTSW 9 111229838 critical splice donor site probably null
R5166:Mlh1 UTSW 9 111241513 missense probably benign 0.04
R5265:Mlh1 UTSW 9 111271523 start codon destroyed probably null 0.92
R5481:Mlh1 UTSW 9 111229837 splice site probably null
R5483:Mlh1 UTSW 9 111231058 missense possibly damaging 0.82
R5602:Mlh1 UTSW 9 111252878 missense probably damaging 0.97
R5658:Mlh1 UTSW 9 111247380 missense probably damaging 0.99
R5890:Mlh1 UTSW 9 111228495 missense possibly damaging 0.88
R6810:Mlh1 UTSW 9 111241558 missense possibly damaging 0.52
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-08-02 11:32 AM by Anne Murray
Record Created 2017-04-25 8:18 AM
Record Posted 2018-08-02
Phenotypic Description

Figure 1. Homozygous andalusia3 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Andalusia3 mice exhibited decreased total IgE levels in the serum. IgE levels were determined by ELISA. Log data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The andalusia3 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5130, some of which showed a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 1). Some mice showed reduced amounts of total IgE in the serum (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced total IgE levels in the serum phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 48 mutations (X-axis) identified in the G1 male of pedigree R5130. Log phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 48 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Mlh1: a T to G transversion at base pair 111,229,838 (v38) on chromosome 9, or base pair 41,949 in the GenBank genomic region NC_000075 in the splice donor site of intron 18. The mutation in Mlh1 was presumed causative as a second allele was discovered in a separate pedigree (R5265; see the record for andalusia2) that phenocopied andalusia3. The strongest association was found with a recessive model of inheritance to the total IgE phenotype, wherein three variant homozygotes departed phenotypically from 36 homozygous reference mice and 29 heterozygous mice with a P value of 0.000315 (Figure 3).  

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in the use of a cryptic site in intron 18. The resulting transcript would have a 56-base pair insertion of intron 18, which would cause a frame shifted protein product beginning after amino acid 705 of the protein, and terminating after the inclusion of three aberrant amino acids.

 

C57BL/6J:

          <--exon 17     <--exon 18 intron 18-->               <--exon 19-->
41533 ……CTGGCCACTGAG ……TCAGGCCAGCAG gtactgtggtaatgtaca…… AGTGACATGCCT……GAGCGGTGTTAA…… 43328
664   ……-L--A--T--E- ……-S--G--Q--Q-                      -S--D--M--P-……-E--R--C--*-   760

 

Genomic numbering corresponds to NC_000075.The donor splice site of intron 18, which is destroyed by the andalusia3 mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 4. Domain organization of MLH1. The andalusia3 destroys the donor splice site of intron 18. Mutations found in the MLH1 protein are shown in red. Click on each mutation for more information.

MLH1 (mutL homolog 1 [E. coli]) is a member of the GHKL (gyrase, Hsp90, histidine kinase, MutL) ATPase/kinase superfamily of proteins (1). MLH1 has an ATPase domain, MutS homolog (MSH2, MSH3, MSH6) interaction domain, EXO1 interaction domain, PMS2/MLH3/PMS1 interaction domain, and a CTH motif.

 

MLH1 forms a heterodimer with PMS2 (designated MutLα), PMS1 (designated MutLβ), or MLH3 (designated MutLγ). MutLα functions in mismatch repair (MMR), the function of MutLβ is unknown, and MutLγ functions in meiotic recombination (2;3).

 

For more information about Mlh1, please see the record andalusia.

Putative Mechanism

During MMR, a MutS heterodimer binds to DNA mismatches (4). Upon binding, the MutS undergoes an ADP to ATP exchange and a conformational change, followed by recruitment of MutLα, MutLβ, or MutLγ. The MutL complexes cleave the defective strand near the mismatch site. The MutS-MutL complex then recruits an exonuclease, subsequently leading to strand-specific excision. PCNA coordinates with the exonuclease to excise the mismatch-containing region. The removed DNA fragment is resynthesized by DNA polymerase δ and the repair process is completed by DNA ligase.

 

In addition to MMR, MLH1 functions in meiotic recombination. MutLγ localizes to sites of crossing over in the meiotic chromosomes (5), and is required for oocytes to progress through metaphase II of meiosis (6). Male and female Mlh1-deficient (Mlh1-/-) mice exhibited infertility (5;7) and premature death. The Mlh1-/- mice showed reduced level of chiasmata (5;8)fa. The chromosomes in Mlh1-/- sperm separate prematurely during spermatogenesis. In addition, the first division of meiosis is frequently arrested (5).

 

Mutations in MLH1 are linked to hereditary nonpolyposis colorectal cancer type 2 (HNPCC2; OMIM: # 609310; (9)), mismatch repair cancer syndrome (OMIM: #276300; (10)), and Muir-Torre syndrome (OMIM: #158320; (11)). Muir-Torre syndrome is an autosomal dominant disorder characterized by development of sebaceous gland tumors and skin cancers, including keratoacanthomas and basal cell carcinomas. Patients can manifest a wide spectrum of internal malignancies, which include colorectal, endometrial, urologic, and upper gastrointestinal neoplasms. Mlh1-/- mice exhibit increased incidences of intestinal adenocarcinomas and adenomas, uterus tumor incidence, skin tumor incidence, and lymphoma incidence (7;12-15).

Primers PCR Primer
andalusia3(F):5'- GGAAGTCTATGTTCTAGTCCAGCAG -3'
andalusia3(R):5'- ACTGTTAAAGCCCTGACTGAAC -3'

Sequencing Primer
andalusia3_seq(F):5'- CGCTATAATCTCAGCACTTAGGAGG -3'
andalusia3_seq(R):5'- GACTGAACTGAATGCTTGCC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Tao Yue, and Bruce Beutler
List |< first << previous [record 19 of 74] next >> last >|