Phenotypic Mutation 'Star_lord' (pdf version)
Allele | Star_lord |
Mutation Type |
missense
|
Chromosome | 11 |
Coordinate | 11,719,448 bp (GRCm39) |
Base Change | T ⇒ A (forward strand) |
Gene |
Ikzf1
|
Gene Name | IKAROS family zinc finger 1 |
Synonym(s) | Zfpn1a1, 5832432G11Rik, LyF-1, Ikaros |
Chromosomal Location |
11,634,980-11,722,926 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014] PHENOTYPE: Homozygous mutants have a variety of T, B, and hematopoeitic cell maturation defects. Heterozygotes for one allele exhibit dominant negative effects and mice develop lymphoproliferative disorders. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_001025597 (variant 1), NM_009578 (variant 2), NM_001301863 (variant 3), NM_001301865 (variant 4), NM_001301866 (variant 5), NM_001301868 (variant 6); MGI:1342540
|
Mapped | Yes |
Amino Acid Change |
Methionine changed to Lysine
|
Institutional Source | Beutler Lab |
Gene Model |
predicted gene model for protein(s):
[ENSMUSP00000018798]
[ENSMUSP00000067372]
[ENSMUSP00000075992]
|
AlphaFold |
no structure available at present |
SMART Domains |
Protein: ENSMUSP00000018798 Gene: ENSMUSG00000018654 AA Change: M385K
Domain | Start | End | E-Value | Type |
ZnF_C2H2
|
58 |
80 |
8.02e-5 |
SMART |
ZnF_C2H2
|
86 |
108 |
2.57e-3 |
SMART |
ZnF_C2H2
|
114 |
137 |
8.22e-2 |
SMART |
low complexity region
|
282 |
293 |
N/A |
INTRINSIC |
ZnF_C2H2
|
371 |
393 |
7.49e0 |
SMART |
ZnF_C2H2
|
399 |
423 |
5.34e-1 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
(Using ENSMUST00000018798)
|
SMART Domains |
Protein: ENSMUSP00000067372 Gene: ENSMUSG00000018654 AA Change: M492K
Domain | Start | End | E-Value | Type |
ZnF_C2H2
|
137 |
159 |
1.43e-1 |
SMART |
ZnF_C2H2
|
165 |
187 |
8.02e-5 |
SMART |
ZnF_C2H2
|
193 |
215 |
2.57e-3 |
SMART |
ZnF_C2H2
|
221 |
244 |
8.22e-2 |
SMART |
low complexity region
|
389 |
400 |
N/A |
INTRINSIC |
ZnF_C2H2
|
478 |
500 |
7.49e0 |
SMART |
ZnF_C2H2
|
506 |
530 |
5.34e-1 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000065433)
|
SMART Domains |
Protein: ENSMUSP00000075992 Gene: ENSMUSG00000018654 AA Change: M472K
Domain | Start | End | E-Value | Type |
ZnF_C2H2
|
117 |
139 |
1.43e-1 |
SMART |
ZnF_C2H2
|
145 |
167 |
8.02e-5 |
SMART |
ZnF_C2H2
|
173 |
195 |
2.57e-3 |
SMART |
ZnF_C2H2
|
201 |
224 |
8.22e-2 |
SMART |
low complexity region
|
369 |
380 |
N/A |
INTRINSIC |
ZnF_C2H2
|
458 |
480 |
7.49e0 |
SMART |
ZnF_C2H2
|
486 |
510 |
5.34e-1 |
SMART |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
(Using ENSMUST00000076700)
|
Meta Mutation Damage Score |
0.9625 |
Is this an essential gene? |
Non Essential (E-score: 0.000) |
Phenotypic Category |
Autosomal Dominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | |
Alleles Listed at MGI | All Mutations and Alleles(14) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(12)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL01302:Ikzf1
|
APN |
11 |
11718923 |
missense |
probably damaging |
1.00 |
IGL01367:Ikzf1
|
APN |
11 |
11698358 |
missense |
probably benign |
0.04 |
IGL01823:Ikzf1
|
APN |
11 |
11719091 |
missense |
possibly damaging |
0.64 |
IGL02342:Ikzf1
|
APN |
11 |
11650216 |
utr 5 prime |
probably benign |
|
IGL02452:Ikzf1
|
APN |
11 |
11698545 |
missense |
probably damaging |
1.00 |
IGL03209:Ikzf1
|
APN |
11 |
11650226 |
missense |
probably benign |
|
IGL03236:Ikzf1
|
APN |
11 |
11657848 |
missense |
probably damaging |
1.00 |
Herrscher
|
UTSW |
11 |
11718961 |
nonsense |
probably null |
|
waxwing
|
UTSW |
11 |
11698464 |
nonsense |
probably null |
|
R0133:Ikzf1
|
UTSW |
11 |
11691015 |
splice site |
probably null |
|
R0417:Ikzf1
|
UTSW |
11 |
11719352 |
missense |
probably benign |
0.19 |
R0633:Ikzf1
|
UTSW |
11 |
11719223 |
missense |
probably damaging |
1.00 |
R0734:Ikzf1
|
UTSW |
11 |
11708195 |
missense |
probably damaging |
1.00 |
R1693:Ikzf1
|
UTSW |
11 |
11657838 |
missense |
probably damaging |
1.00 |
R2114:Ikzf1
|
UTSW |
11 |
11719473 |
missense |
probably damaging |
1.00 |
R2927:Ikzf1
|
UTSW |
11 |
11719324 |
missense |
probably damaging |
1.00 |
R4250:Ikzf1
|
UTSW |
11 |
11704166 |
missense |
probably damaging |
1.00 |
R5156:Ikzf1
|
UTSW |
11 |
11719448 |
missense |
probably damaging |
1.00 |
R5912:Ikzf1
|
UTSW |
11 |
11698464 |
nonsense |
probably null |
|
R6274:Ikzf1
|
UTSW |
11 |
11718961 |
nonsense |
probably null |
|
R7614:Ikzf1
|
UTSW |
11 |
11719019 |
missense |
probably damaging |
1.00 |
R7727:Ikzf1
|
UTSW |
11 |
11698339 |
missense |
probably damaging |
1.00 |
R7759:Ikzf1
|
UTSW |
11 |
11719256 |
missense |
probably damaging |
0.98 |
R8758:Ikzf1
|
UTSW |
11 |
11711359 |
missense |
probably benign |
0.03 |
R8946:Ikzf1
|
UTSW |
11 |
11719485 |
missense |
possibly damaging |
0.86 |
R8998:Ikzf1
|
UTSW |
11 |
11635013 |
start gained |
probably benign |
|
R8999:Ikzf1
|
UTSW |
11 |
11635013 |
start gained |
probably benign |
|
R9624:Ikzf1
|
UTSW |
11 |
11719219 |
missense |
probably damaging |
1.00 |
Z1176:Ikzf1
|
UTSW |
11 |
11708194 |
critical splice acceptor site |
probably null |
|
|
Mode of Inheritance |
Autosomal Dominant |
Local Stock | |
Repository | |
Last Updated |
2019-09-04 9:40 PM
by Diantha La Vine
|
Record Created |
2017-05-11 12:54 PM
|
Record Posted |
2018-08-22 |
Phenotypic Description |
The Star_lord phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5156, some of which showed reduced heart rates on day 3 of testing (Figure 1) as well as reduced average heart rates (Figure 2) compared to wild-type littermates. Some mice also showed increased T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 3). The mice showed reduced B to T cell ratios (Figure 4) and reduced CD4 to CD8 T cell ratios (Figure 5) as well as reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 6), naïve CD4 T cells in CD4 T cells (Figure 7), and naïve CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of T cells (Figure 9), CD44+ CD4 T cells (Figure 10), CD8+ T cells (Figure 11), CD8+ T cells in CD3+ T cells (Figure 12), central memory CD4 T cells in CD4 T cells (Figure 13), central memory CD8 T cells in CD8 T cells (Figure 14), effector memory CD4 T cells in CD4 T cells (Figure 15), and B1 cells (Figure 16), all in the peripheral blood. The expression of CD44 on peripheral blood CD8 T cells was increased (Figure 17). The mice also showed diminished NK cell-associated cytotoxicity (Figure 18).
|
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ikzf1: a T to A transversion at base pair 11,769,448 (v38) on chromosome 11, or base pair 84,479 in the GenBank genomic region NC_000077 encoding Ikzf1. The strongest association was found with a additive/dominant model of inheritance to the increased CD8+ T cell in CD3+ T cell frequency, wherein 27 heterozygous mice departed phenotypically from 29 homozygous reference mice with a P value of 1.655 x 10-16 (Figure 19); pedigree R5156 did not have any variant homozygous mice. The mutation corresponds to residue 1,972 in the mRNA sequence NM_001025597 within exon 8 of 8 total exons and to residue 1,711 in the mRNA sequence NM_009578 within exon 7 of 7 total exons.
84464 TTCCTGGATCACGTCATGTATACCATTCACATG
467 -F--L--D--H--V--M--Y--T--I--H--M- (variants 1, 3, and 6)
380 -F--L--D--H--V--M--Y--T--I--H--M- (variants 2, 4, and 5)
|
Genomic numbering corresponds to NC_000077. The mutated nucleotide is indicated in red. The mutation results in a methionine to lysine substitution at amino acid 472 (M472K) in variant 1 of the IKZF1 protein and a M385K substitution in variant 2 of the IKZF1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.994, variant 1; score = 0.987, variant 2).
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction |
Ikzf1 (IKAROS family zinc finger 1) encodes IKAROS (alternatively, IK1). IKAROS is a member of the IKAROS family of zinc finger transcription factors, which also includes HELIOS (IKZF2), AIOLOS (IKZF3), EOS (IKZF4), and PEGASUS (IKZF5). IKAROS has six C2H2-type zinc fingers, with four at the N-terminus and two at the C-terminus (Figure 20) (1). The N-terminal zinc fingers mediate binding to the core DNA motif A/GGGAA in target genes. The C-terminal zinc fingers mediate IKAROS homodimerization as well as IKAROS heterodimerization with other members of the IKAROS protein family (2). Dimerization of the IKAROS proteins enhances their DNA affinity and transcriptional activity. IKAROS is phosphorylated by casein kinase II on several serine and threonine residues. IKAROS phosphorylation reduces its DNA-binding activity (3;4). Protein phosphatase-1-mediated dephosphorylation of IKAROS restores IKAROS activity (3). BTK- and SYK (see the record for poppy)-mediated phosphorylation of serines near the IKAROS DNA-binding domain promotes IKAROS nuclear localization and DNA binding activity (5;6). In the nucleus, IKAROS is SUMOylated, which interferes with transcriptional repression (7;8). Ubiquitination of IKAROS promotes its proteasomal degradation (3). Alternative splicing of IKZF1 produces several IKAROS variants [Table 1; reviewed in (9)]. The protein variants differ in the number of N-terminal zinc fingers. Several of the variants can function as dominant-negative versions of IKAROS. For example, the IK6 variant lacks exons 4 to 7, which encode the four N-terminal zinc fingers. IK6 is able to interact with full-length IKAROS proteins, but lacks DNA binding activity. Table 1. The IKZF1 splice variants
Variant
|
Splice variant (cDNA) description
|
Protein description
|
IK1
|
Canonical full-length isoform
|
Canonical full-length isoform
|
IK2
|
Lacks exon 4
|
Lacks the first zinc finger
|
IK2A
|
Lacks exon 4 and 7
|
Lacks the first zinc finger
|
IK3
|
Lacks exon 6 and 7
|
Lacks the fourth zinc finger
|
IK4
|
Lacks exons 4 and 6, but retains exon 5
|
Lacks the first and fourth zinc fingers
|
IK4A
|
Lacks exon 4, 6, and 7
|
Lacks the first and fourth zinc fingers
|
IK5*
|
Lacks exons 5 through 7
|
Lacks the second through fourth zinc fingers
|
IK6*
|
Lacks exons 4 through 7
|
Lacks first four zinc fingers
|
IK7*
|
Lacks exons 4 and 5
|
Lacks the first through third zinc fingers
|
IK8*
|
Lacks exons 4 through 6
|
Lacks the first four zinc fingers
|
IK9*
|
Lacks exons 3 through 7
|
Lacks first four zinc fingers
|
IKX
|
Lacks exon 6
|
Lacks the fourth zinc finger
|
* isoforms are dominant negative The star_lord mutation results in a methionine to lysine substitution at amino acid 472 (M472K) in variant 1 of the IKZF1 protein; Met472 is within the fifth zinc finger.
|
Expression/Localization | IKAROS is expressed during early embryonic hematopoiesis in mice (10;11). IKAROS is also expressed in erythroid and myeloid precursors (12). In the adult, IKAROS is expressed in the spleen, thymus, and peripheral blood leukocytes (1;10;11).
|
Background |
Hematopoietic stem cells (HSCs) give rise to multipotent progenitors, which branch into myeloid and lymphoid lineages (Figure 21). The myeloid lineage starts with the common myeloid progenitor (CMP), which gives rise to the megakaryocyte-erythroid progenitors, granulocyte-macrophage progenitors, or early T-cell progenitors. In the lymphoid lineage, common lymphoid progenitors (CLPs) are divided into Ly6D-negative all-lymphoid progenitors (ALPs) and Ly6D-positive B cell biased lymphoid progenitors (BLPs) (13). The ALPs generate B cells, T cells, natural killer cells, and lymphoid dendritic cells, while the BLPs are biased towards the B cell lineage. IKAROS is a transcription factor that regulates the expression of genes that mediate the production of blood and immune cells, promotes precursor self-renewal, CLP generation from HSCs, B and NK cell lineages from CLPs, inhibition of CMP differentiation, neutrophil generation from granulocyte-macrophage progenitors, and generation of erythroid cells from megakaryocyte-erythroid progenitors [Table 2; reviewed in (14)]. Table 2. Select IKAROS target genes
Target function
|
Target genes
|
References
|
Antigen receptor and recombination machinery
|
Dntt
|
(15;16)
|
Rag1 (see the record for maladaptive)
|
(17)
|
Rag2 (see the record for snowcock)
|
Cd79b (see the record for hallasan)
|
(18)
|
Pre-B-cell receptor signaling, cell survival, stromal-cell adhesion and B-cell commitment during pre-B-cell differentiation
|
Pax5 (see the record for glacier)
|
(18-20)
|
Foxo1
|
Ebf1 (see the record for crater_lake)
|
Signal transducers and cell surface receptors in B- and T-cell differentiation
|
Kit (see the record for pretty2)
|
(20)
|
Flt3 (see the record for warmflash)
|
Cd79b
|
Notch1 (see the record for Antero)
|
Btla (see the record for Enigmatic)
|
Clnk
|
Ltb
|
Ccr9
|
Il7r
|
Cd8a (see the record for alfalfa)
|
(21)
|
Tbx21 (see the record for plateau)
|
(22;23)
|
Cell adhesion
|
Ctnnd1
|
(24)
|
Fak
|
(25)
|
Itga5
|
(26)
|
Chromatin remodelers and transcription regulators
|
Satb1
|
(27)
|
Mef2c
|
Runx2
|
Sox4
|
Foxp1 (see the record for foxy)
|
Hdac9
|
Ets1
|
IKAROS regulates lymphocyte differentiation and function by promoting chromatin remodeling (10;12;28-33). IKAROS associates with the nucleosome remodeling and deacetylase complex (termed the NuRD complex), which includes histone deacetylases HDAC1 and HDAC2 as well as the ATP-dependent chromatin remodeling proteins CHD3 and CHD4 (alternatively, Mi-2β). MTA1, MTA2, MBD3, and Rbp46/48 are also components of the NuRD complex (34). IKAROS also associates with polycomb repressive complex-2, which promotes histone H3 lysine 27 trimethylation to maintain genes in an inactive state (35;36). The transcriptional co-factors CtBP, CtIP, and SW/SNF-related complex also can associate with IKAROS (37-39). IKAROS also may directly regulate transcription by interaction with the general transcription factors TFIIB and TBP (40). IKAROS also functions in transcription elongation (3). IKAROS promotes the transfer of protein phosphatase 1α to CDK9, which activates positive transcription elongation factor b and subsequent transcription elongation of IKAROS target genes (3). IKAROS also functions in chromatin accessibility during immunoglobulin gene rearrangement and allelic exclusion at the Igk locus (17;20). Mutations in IKZF1 are associated with common variable immunodeficiency-13 (OMIM: #616873) (32;33). Patients with common variable immunodeficiency-13 exhibit recurrent bacterial infections, hypogammaglobulinemia, and decreased numbers of B cells (32;33). Some patients also have reduced numbers of NK cells and increased numbers of T lymphocytes (32). Dominant negative mutations in IKZF1 are linked to acute lymphoblastic leukemia (ALL) in infants and adults (41-43). Patients with ALL exhibit uncontrolled B-lymphoid progenitor expansion in the bone marrow. Ikzf1-deficient (Ikzf1-/-) mice typically (95%) exhibited postnatal lethality by four weeks of age due to bacterial infections (28). The Ikzf1-/-mice exhibited reduced body sizes compared to wild-type mice (28). Ikzf1-/- mice exhibited reduced circulating adrenocorticotrophic hormone levels, adrenal glucocorticoid insufficiency, and contraction of the pituitary corticomelanotroph population due to loss of IKAROS-associated proopiomelanocortin gene expression (44). Homozygous mice expressing an ENU-induced mutant Ikzf1 allele (Ikzf1plastc/plastc; H191R) exhibited embryonic lethality between embryonic days 15.5 and 17.5 due to fetal anemia (29). The Ikzf1plastc/plastc embryos showed thymus and liver hypoplasia, a failure in T and B cell differentiation, increased numbers of granulocyte/macrophage progenitor cells, reduced numbers of erythroid progenitor cells, aberrant erythroblast differentiation and growth (29). Homozygous mice expressing a mutant Ikzf1 allele that is missing zinc finger 1 (Ikzf1deltaF1/deltaF1) exhibited reduced numbers of immature B cells as well as pre-B, B1a, and B1b cell numbers, thymus hypoplasia, and reduced numbers of DN1 thymic pro-T cells (30).
|
Putative Mechanism | Ikzf1-/- mice also exhibited reduced numbers of B1a, B1b cells, NK cells, and double-positive T cells, deficient B cell differentiation, reduced spleen germinal center number, aberrant B cell activation and proliferation after IL-7 stimulation, and reduced IgG3 levels (12;28;31). The phenotype of the star_lord mice indicates abberant IKZF1star_lord-associated function in lymphocyte differentiation and function.
|
Primers |
PCR Primer
Star_lord_pcr_F: AGCGGCCTTATCTACCTAACC
Star_lord_pcr_R: AACATTGTCCGCTGTGGGTC
Sequencing Primer
Star_lord_seq_F: GGCCTTATCTACCTAACCAACCAC
Star_lord_seq_R: AGGAGGCATAACCAGCTATCTTTGTG
|
Genotyping | PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40x 6) 72°C 10:00 7) 4°C hold
The following sequence of 416 nucleotides is amplified (chromosome 11, + strand):
1 agcggcctta tctacctaac caaccacatc aacccgcatg cacgcaatgg gctggctctc 61 aaggaggagc agcgcgccta cgaggtgctg agggcggcct cagagaactc gcaggatgcc 121 ttccgtgtgg tcagcacgag tggcgagcag ctgaaggtgt acaagtgcga acactgccgc 181 gtgctcttcc tggatcacgt catgtatacc attcacatgg gctgccatgg ctttcgggat 241 ccctttgagt gtaacatgtg tggttatcac agccaggaca ggtacgagtt ctcatcccat 301 atcacgcggg gggagcatcg ttaccacctg agctaaaccc agccaggccc cactgaagca 361 caaagatagc tggttatgcc tccttcccgg cagctggacc cacagcggac aatgtt
Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. |
References |
2. Dijon, M., Bardin, F., Murati, A., Batoz, M., Chabannon, C., and Tonnelle, C. (2008) The Role of Ikaros in Human Erythroid Differentiation. Blood. 111, 1138-1146.
3. Popescu, M., Gurel, Z., Ronni, T., Song, C., Hung, K. Y., Payne, K. J., and Dovat, S. (2009) Ikaros Stability and Pericentromeric Localization are Regulated by Protein Phosphatase 1. J Biol Chem. 284, 13869-13880.
5. Uckun, F. M., Ma, H., Zhang, J., Ozer, Z., Dovat, S., Mao, C., Ishkhanian, R., Goodman, P., and Qazi, S. (2012) Serine Phosphorylation by SYK is Critical for Nuclear Localization and Transcription Factor Function of Ikaros. Proc Natl Acad Sci U S A. 109, 18072-18077.
6. Ma, H., Qazi, S., Ozer, Z., Zhang, J., Ishkhanian, R., and Uckun, F. M. (2013) Regulatory Phosphorylation of Ikaros by Bruton's Tyrosine Kinase. PLoS One. 8, e71302.
7. Apostolov, A., Litim-Mecheri, I., Oravecz, A., Goepp, M., Kirstetter, P., Marchal, P., Ittel, A., Mauvieux, L., Chan, S., and Kastner, P. (2016) Sumoylation Inhibits the Growth Suppressive Properties of Ikaros. PLoS One. 11, e0157767.
10. Molnar, A., Wu, P., Largespada, D. A., Vortkamp, A., Scherer, S., Copeland, N. G., Jenkins, N. A., Bruns, G., and Georgopoulos, K. (1996) The Ikaros Gene Encodes a Family of Lymphocyte-Restricted Zinc Finger DNA Binding Proteins, Highly Conserved in Human and Mouse. J Immunol. 156, 585-592.
12. Kirstetter, P., Thomas, M., Dierich, A., Kastner, P., and Chan, S. (2002) Ikaros is Critical for B Cell Differentiation and Function. Eur J Immunol. 32, 720-730.
13. Inlay, M. A., Bhattacharya, D., Sahoo, D., Serwold, T., Seita, J., Karsunky, H., Plevritis, S. K., Dill, D. L., and Weissman, I. L. (2009) Ly6d Marks the Earliest Stage of B-Cell Specification and Identifies the Branchpoint between B-Cell and T-Cell Development. Genes Dev. 23, 2376-2381.
15. Hahm, K., Ernst, P., Lo, K., Kim, G. S., Turck, C., and Smale, S. T. (1994) The Lymphoid Transcription Factor LyF-1 is Encoded by Specific, Alternatively Spliced mRNAs Derived from the Ikaros Gene. Mol Cell Biol. 14, 7111-7123.
17. Reynaud, D., Demarco, I. A., Reddy, K. L., Schjerven, H., Bertolino, E., Chen, Z., Smale, S. T., Winandy, S., and Singh, H. (2008) Regulation of B Cell Fate Commitment and Immunoglobulin Heavy-Chain Gene Rearrangements by Ikaros. Nat Immunol. 9, 927-936.
18. Ferreiros-Vidal, I., Carroll, T., Taylor, B., Terry, A., Liang, Z., Bruno, L., Dharmalingam, G., Khadayate, S., Cobb, B. S., Smale, S. T., Spivakov, M., Srivastava, P., Petretto, E., Fisher, A. G., and Merkenschlager, M. (2013) Genome-Wide Identification of Ikaros Targets Elucidates its Contribution to Mouse B-Cell Lineage Specification and Pre-B-Cell Differentiation. Blood. 121, 1769-1782.
19. Iacobucci, I., Iraci, N., Messina, M., Lonetti, A., Chiaretti, S., Valli, E., Ferrari, A., Papayannidis, C., Paoloni, F., Vitale, A., Storlazzi, C. T., Ottaviani, E., Guadagnuolo, V., Durante, S., Vignetti, M., Soverini, S., Pane, F., Foa, R., Baccarani, M., Muschen, M., Perini, G., and Martinelli, G. (2012) IKAROS Deletions Dictate a Unique Gene Expression Signature in Patients with Adult B-Cell Acute Lymphoblastic Leukemia. PLoS One. 7, e40934.
20. Schwickert, T. A., Tagoh, H., Gultekin, S., Dakic, A., Axelsson, E., Minnich, M., Ebert, A., Werner, B., Roth, M., Cimmino, L., Dickins, R. A., Zuber, J., Jaritz, M., and Busslinger, M. (2014) Stage-Specific Control of Early B Cell Development by the Transcription Factor Ikaros. Nat Immunol. 15, 283-293.
21. Harker, N., Naito, T., Cortes, M., Hostert, A., Hirschberg, S., Tolaini, M., Roderick, K., Georgopoulos, K., and Kioussis, D. (2002) The CD8alpha Gene Locus is Regulated by the Ikaros Family of Proteins. Mol Cell. 10, 1403-1415.
22. Thomas, R. M., Chen, C., Chunder, N., Ma, L., Taylor, J., Pearce, E. J., and Wells, A. D. (2010) Ikaros Silences T-Bet Expression and Interferon-Gamma Production during T Helper 2 Differentiation. J Biol Chem. 285, 2545-2553.
23. Quirion, M. R., Gregory, G. D., Umetsu, S. E., Winandy, S., and Brown, M. A. (2009) Cutting Edge: Ikaros is a Regulator of Th2 Cell Differentiation. J Immunol. 182, 741-745.
24. Schjerven, H., Ayongaba, E. F., Aghajanirefah, A., McLaughlin, J., Cheng, D., Geng, H., Boyd, J. R., Eggesbo, L. M., Lindeman, I., Heath, J. L., Park, E., Witte, O. N., Smale, S. T., Frietze, S., and Muschen, M. (2017) Genetic Analysis of Ikaros Target Genes and Tumor Suppressor Function in BCR-ABL1(+) Pre-B ALL. J Exp Med. 214, 793-814.
25. Churchman, M. L., Evans, K., Richmond, J., Robbins, A., Jones, L., Shapiro, I. M., Pachter, J. A., Weaver, D. T., Houghton, P. J., Smith, M. A., Lock, R. B., and Mullighan, C. G. (2016) Synergism of FAK and Tyrosine Kinase Inhibition in Ph(+) B-ALL. JCI Insight. 1, 10.1172/jci.insight.86082. Epub 2016 Apr 7.
26. Joshi, I., Yoshida, T., Jena, N., Qi, X., Zhang, J., Van Etten, R. A., and Georgopoulos, K. (2014) Loss of Ikaros DNA-Binding Function Confers Integrin-Dependent Survival on Pre-B Cells and Progression to Acute Lymphoblastic Leukemia. Nat Immunol. 15, 294-304.
27. Uckun, F. M., Ma, H., Ishkhanian, R., Arellano, M., Shahidzadeh, A., Termuhlen, A., Gaynon, P. S., and Qazi, S. (2013) Constitutive Function of the Ikaros Transcription Factor in Primary Leukemia Cells from Pediatric Newly Diagnosed High-Risk and Relapsed B-Precursor ALL Patients. PLoS One. 8, e80732.
28. Georgopoulos, K., Bigby, M., Wang, J. H., Molnar, A., Wu, P., Winandy, S., and Sharpe, A. (1994) The Ikaros Gene is Required for the Development of all Lymphoid Lineages. Cell. 79, 143-156.
29. Papathanasiou, P., Perkins, A. C., Cobb, B. S., Ferrini, R., Sridharan, R., Hoyne, G. F., Nelms, K. A., Smale, S. T., and Goodnow, C. C. (2003) Widespread Failure of Hematolymphoid Differentiation Caused by a Recessive Niche-Filling Allele of the Ikaros Transcription Factor. Immunity. 19, 131-144.
30. Schjerven, H., McLaughlin, J., Arenzana, T. L., Frietze, S., Cheng, D., Wadsworth, S. E., Lawson, G. W., Bensinger, S. J., Farnham, P. J., Witte, O. N., and Smale, S. T. (2013) Selective Regulation of Lymphopoiesis and Leukemogenesis by Individual Zinc Fingers of Ikaros. Nat Immunol. 14, 1073-1083.
31. Wang, J. H., Nichogiannopoulou, A., Wu, L., Sun, L., Sharpe, A. H., Bigby, M., and Georgopoulos, K. (1996) Selective Defects in the Development of the Fetal and Adult Lymphoid System in Mice with an Ikaros Null Mutation. Immunity. 5, 537-549.
32. Goldman, F. D., Gurel, Z., Al-Zubeidi, D., Fried, A. J., Icardi, M., Song, C., and Dovat, S. (2012) Congenital Pancytopenia and Absence of B Lymphocytes in a Neonate with a Mutation in the Ikaros Gene. Pediatr Blood Cancer. 58, 591-597.
33. Kuehn, H. S., Boisson, B., Cunningham-Rundles, C., Reichenbach, J., Stray-Pedersen, A., Gelfand, E. W., Maffucci, P., Pierce, K. R., Abbott, J. K., Voelkerding, K. V., South, S. T., Augustine, N. H., Bush, J. S., Dolen, W. K., Wray, B. B., Itan, Y., Cobat, A., Sorte, H. S., Ganesan, S., Prader, S., Martins, T. B., Lawrence, M. G., Orange, J. S., Calvo, K. R., Niemela, J. E., Casanova, J. L., Fleisher, T. A., Hill, H. R., Kumanovics, A., Conley, M. E., and Rosenzweig, S. D. (2016) Loss of B Cells in Patients with Heterozygous Mutations in IKAROS. N Engl J Med. 374, 1032-1043.
34. Kim, J., Sif, S., Jones, B., Jackson, A., Koipally, J., Heller, E., Winandy, S., Viel, A., Sawyer, A., Ikeda, T., Kingston, R., and Georgopoulos, K. (1999) Ikaros DNA-Binding Proteins Direct Formation of Chromatin Remodeling Complexes in Lymphocytes. Immunity. 10, 345-355.
36. Oravecz, A., Apostolov, A., Polak, K., Jost, B., Le Gras, S., Chan, S., and Kastner, P. (2015) Ikaros Mediates Gene Silencing in T Cells through Polycomb Repressive Complex 2. Nat Commun. 6, 8823.
39. O'Neill, D. W., Schoetz, S. S., Lopez, R. A., Castle, M., Rabinowitz, L., Shor, E., Krawchuk, D., Goll, M. G., Renz, M., Seelig, H. P., Han, S., Seong, R. H., Park, S. D., Agalioti, T., Munshi, N., Thanos, D., Erdjument-Bromage, H., Tempst, P., and Bank, A. (2000) An Ikaros-Containing Chromatin-Remodeling Complex in Adult-Type Erythroid Cells. Mol Cell Biol. 20, 7572-7582.
41. Sun, L., Heerema, N., Crotty, L., Wu, X., Navara, C., Vassilev, A., Sensel, M., Reaman, G. H., and Uckun, F. M. (1999) Expression of Dominant-Negative and Mutant Isoforms of the Antileukemic Transcription Factor Ikaros in Infant Acute Lymphoblastic Leukemia. Proc Natl Acad Sci U S A. 96, 680-685.
42. Nakase, K., Ishimaru, F., Avitahl, N., Dansako, H., Matsuo, K., Fujii, K., Sezaki, N., Nakayama, H., Yano, T., Fukuda, S., Imajoh, K., Takeuchi, M., Miyata, A., Hara, M., Yasukawa, M., Takahashi, I., Taguchi, H., Matsue, K., Nakao, S., Niho, Y., Takenaka, K., Shinagawa, K., Ikeda, K., Niiya, K., and Harada, M. (2000) Dominant Negative Isoform of the Ikaros Gene in Patients with Adult B-Cell Acute Lymphoblastic Leukemia. Cancer Res. 60, 4062-4065.
43. Mullighan, C. G., Su, X., Zhang, J., Radtke, I., Phillips, L. A., Miller, C. B., Ma, J., Liu, W., Cheng, C., Schulman, B. A., Harvey, R. C., Chen, I. M., Clifford, R. J., Carroll, W. L., Reaman, G., Bowman, W. P., Devidas, M., Gerhard, D. S., Yang, W., Relling, M. V., Shurtleff, S. A., Campana, D., Borowitz, M. J., Pui, C. H., Smith, M., Hunger, S. P., Willman, C. L., Downing, J. R., and Children's Oncology Group. (2009) Deletion of IKZF1 and Prognosis in Acute Lymphoblastic Leukemia. N Engl J Med. 360, 470-480.
44. Ezzat, S., Mader, R., Yu, S., Ning, T., Poussier, P., and Asa, S. L. (2005) Ikaros Integrates Endocrine and Immune System Development. J Clin Invest. 115, 1021-1029.
|
Science Writers | Anne Murray |
Illustrators | Diantha La Vine |
Authors | Samantha Teixeira, Xue Zhong, Jin Huk Choi, and Bruce Beutler |