Phenotypic Mutation 'Potter2' (pdf version)
AllelePotter2
Mutation Type missense
Chromosome15
Coordinate78,565,454 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Rac2
Gene Name Rac family small GTPase 2
Chromosomal Location 78,559,167-78,572,783 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009008; MGI:97846

Mapped Yes 
Limits of the Critical Region 78559169 - 78572783 bp
Amino Acid Change Asparagine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036384] [ENSMUSP00000154826]
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: N92S

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
(Using ENSMUST00000043214)
Predicted Effect probably benign
Predicted Effect probably benign
Meta Mutation Damage Score 0.9322 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
CD8 response - decreased
CTL killing - decreased
CTL killing dominant epitope - decreased
FACS B:T cells - increased
FACS B220 MFI - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased
NK cell response - decreased
NK killing - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.862; ML prob: 0.808; human score: 4
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(2) Radiation induced(2) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense possibly damaging 0.79
Big_bend UTSW 15 78565945 missense possibly damaging 0.95
bingo UTSW 15 78564968 missense probably damaging 1.00
Lamb UTSW 15 78564934 missense possibly damaging 0.68
Potter UTSW 15 78570743 nonsense probably null
wheel UTSW 15 78566006 missense probably benign 0.29
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0627:Rac2 UTSW 15 78564968 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R2349:Rac2 UTSW 15 78565475 missense possibly damaging 0.51
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5051:Rac2 UTSW 15 78564934 missense possibly damaging 0.68
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
R7384:Rac2 UTSW 15 78561931 nonsense probably null
R8482:Rac2 UTSW 15 78566006 missense probably benign 0.29
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:40 PM by Anne Murray
Record Created 2017-05-17 11:54 PM by Jin Huk Choi
Record Posted 2017-08-18
Phenotypic Description

Figure 1. Potter2 mice exhibit an increased B to T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Potter2 mice exhibit a reduced CD4 to CD8 T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Potter2 mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Potter2 mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Potter2 mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Potter2 mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Potter2 mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Potter2 mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Potter2 mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Potter2 mice exhibit increased frequencies of peripheral CD44+ CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Potter2 mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Potter2 mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Potter2 mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Potter2 mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Potter2 mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Potter2 mice exhibit reduced expression of B220 on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Potter2 mice exhibit reduced expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Potter2 mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 19. Potter2 mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 20. Potter2 mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 21. Potter2 mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 22. Potter2 mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 23. Potter2 mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 24. Potter2 mice exhibited decreased rates of cytotoxic T lymphocyte-mediated target cell killing. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 25. Potter2 mice exhibited decreased rates of natural killer cell-mediated target cell killing. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 26. Potter2 mice exhibited decreased total IgE secretion in response to OVA/Alum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Potter2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5207, some of which showed an increase in the B:T cell ratio (Figure 1) as well as a reduced CD4 to CD8 T cell ratio (Figure 2). Some mice showed reduced frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), CD4+ T cells in CD3+ T cells (Figure 5), naive CD4 T cells in CD4 T cells (Figure 6), CD8+ T cells (Figure 7), and naive CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of CD44+ T cells (Figure 9), CD44+ CD8 T cells (Figure 10), CD8+ T cells in CD3+ T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), effector memory CD8 T cells in CD8 T cells (Figure 13), central memory CD4 T cells in CD4 T cells (Figure 14), and effector memory CD4 T cells in CD4 T cells (Figure 15), all in the peripheral blood. The expression of B220 (Figure 16) and IgD (Figure 17) were reduced on peripheral B cells and the expression of CD44 was increased on peripheral T cells (Figure 18), CD4 T cells (Figure 19), and CD8 T cells (Figure 20). The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 21) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal; Figure 22) were also diminished. The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also reduced (Figure 23). The rates of cytotoxic T lymphocyte (Figure 24)- and natural killer cell (Figure 25)-mediated target cell killing was reduced. The amount of total IgE in the serum was reduced seven days after OVA/Alum challenge (Figure 26).

Nature of Mutation

Figure 27. Linkage mapping of the CD44 expression on CD8 T cells phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R5207. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 15: Rac2 and Tcf20. The mutation in Rac2 was presumed to be causative because the potter2 phenotypes mimic other known alleles of Rac2 (see MGI for a list of Rac2 alleles). The mutation in Rac2 is an A to G transition at base pair 78,565,454 (v38) on chromosome 15, or base pair 7,330 in the GenBank genomic region NC_000081 encoding the Rac2 gene. The strongest association was found with an additive model of inheritance to the normalized amount of CD44 on CD8 T cells phenotype, wherein two variant homozygotes and 36 heterozygous mice departed phenotypically from 34 homozygous reference mice with a P value of 2.42 x 10-36 (Figure 27). Although a substantial semidominant effect was observed in most of the assays, some assays exhibited strongest linkage with a recessive model of inheritance or with a dominant model of inheritance. 

 

The mutation corresponds to residue 413 in the mRNA sequence NM_009008 within exon 4 of 7 total exons.


 
397 CCAGCCTCCTATGAGAATGTCCGTGCCAAGTGG
87  -P--A--S--Y--E--N--V--R--A--K--W-

 

The mutated nucleotide is indicated in red.  The mutation results in an asparagine to serine substitution at position 92 (N92S) in the Rac2 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.971).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 28. Protein domains of Rac2. Rac proteins have five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions, and a C-terminal polybasic region. The amino acid altered in Potter2 is indicated. The image is interactive; click to view additional mutations in Rac2.

Rac2 is a member of the Rac subfamily of Rho guanosine triphosphatases (Rho GTPases). Rho GTPases have several conserved domains including five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions (switch I and II), a polybasic domain, and a prenylation site [Figure 28; (1)]. G-boxes function in GDP binding and exhibit GTPase activity (2). In Rac2, these regions correspond to amino acids 10-17 (G1), Thr35 (G2), 57-61 (G3), and 115-118 (G4), and 157-160 (G5). The Rac proteins each have two highly conserved switch regions, switch I (amino acids 27-40) and switch II (amino acids 56-71), situated on either side of the bound nucleotide. Both switch regions are sites of interactions between the Rac proteins and guanine nucleotide exchange factors (GEFs) and guanine nucleotide-dissociation inhibitors (GDIs) as well as with downstream protein targets (3). The polybasic region of Rac2 (RQQKRP; amino acids 183-188) is required for its function as a regulator of NAPDH oxidase.

 

The mutation in Potter2 results in an asparagine to serine substitution at position 92 (N92S). Amino acid 65 is within an undefined region between the G3 and G4 regions.

 

For more information about Rac2, please see the record for bingo.

Putative Mechanism

Rho GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. Rac2 functions in actin polymerization resulting in lamellopodial extension and membrane ruffling, directed migration, chemotaxis, and superoxide (O2) production in phagocytic cells as well as cytoskeleton organization in red blood cells and osteoclasts (4-9). The Rac proteins regulate leukocyte migration by transducing signals from cell surface receptors (e.g., the Fcγ receptor, formylmethionyl-leucyl-phenylalanine (fMLP) receptor, and β2 integrins) to the actin and microtubule cytoskeletons through cytoplasmic effectors (e.g., tyrosine kinases, scaffolding/adapter proteins, nucleotide exchange proteins, and phosphatases) upon binding of GTP (10).

 

Rac2 is required for B cell development as well as for either B cell receptor (BCR) signal transduction and subsequent calcium mobilization or in determining the efficiency of BCR ligation (11;12). Rac2-deficient (Rac2-/-) mice exhibit a 30% reduction in B cell numbers due mainly be a reduced number of recirculating B lymphocytes in the bone marrow (11). Rac2-/- mice also display a lack of peritoneal B1 and marginal zone B cells (11). In the peripheral blood, Rac2-/- mice had an increase in total leukocyte number including both B and T cells (11). B cell numbers were reduced in the spleen due to a loss of mature and/or marginal zone B cells (11). In humans, mutations in RAC2 are linked to neutrophil (alternatively, phagocytic) immunodeficiency syndrome [NIS; OMIM: #608203; (13-15)] and decreased numbers of peripheral T and B cells. Patients with NIS have severe, recurrent infections, poor wound healing, and exhibit reduced neutrophil migration, azurophilic granule secretion, and superoxide production (13-15).

 

The immune phenotypes observed in Potter2 indicates a loss of Rac2Potter2 function; however, some Rac2 function may remain or Rac1 may be compensating for the loss of Rac2 function and/or expression as other Rac2-/--associated phenotypes were not observed in the Potter2 mice.

Primers PCR Primer
Potter2_pcr_F: AAGAGTCAAGCGAGTTTGTGTG
Potter2_pcr_R: TTTCTCAGTGTGTGCCAGGC

Sequencing Primer
Potter2_seq_F: TTGTGTGTTGATAAGAAGAGGCAC
Potter2_seq_R: CTTCTGGGTCCCTAGAGCTG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 528 nucleotides is amplified (chromosome 15, - strand):


1   tttctcagtg tgtgccaggc aggggctagt gtgcctggag ctggggtagg caggtggcct
61  gctgcagggg actctgtggc ttctgggtcc ctagagctgg gctctctacc cacaagggca
121 aagggagtcg gcaggtagat ggttatggga gccgagggat ggtttcccag acaggaccct
181 ggcctcccta tgctaacctg ccctgttctg tatttaggat gtatttctca tctgcttctc
241 gctagtcagc ccagcctcct atgagaatgt ccgtgccaag gtgagccacg agtggcctgg
301 gaagggtgct gaggaaaggg gaatgggcta tcctgggtta ggagaggcca ggggagagag
361 ggtcactagt accacacagg accaatgaga ggagagtctc cttgggctgt gtgtgtgttg
421 tggggggagg ggtgggacag tgagggttcc tcctgcctct gagccctgtc cctttgtcta
481 tccaacctcg tgcctcttct tatcaacaca caaactcgct tgactctt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJin Huk Choi, Braden Hayse, Xue Zhong, Evan Nair-Gill, and Bruce Beutler