Phenotypic Mutation 'Lamb' (pdf version)
AlleleLamb
Mutation Type missense
Chromosome15
Coordinate78,564,934 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Rac2
Gene Name Rac family small GTPase 2
Chromosomal Location 78,559,167-78,572,783 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009008; MGI:97846

Mapped Yes 
Amino Acid Change Isoleucine changed to Threonine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000036384] [ENSMUSP00000154826]
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: I126T

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
(Using ENSMUST00000043214)
Predicted Effect probably benign
Predicted Effect possibly damaging

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
(Using ENSMUST00000230952)
Meta Mutation Damage Score 0.1368 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1a cells in B1 cells - decreased
FACS B1b cells in B1 cells - increased
Candidate Explorer Status CE: good candidate; Verification probability: 0.718; ML prob: 0.666; human score: -4
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(2) Radiation induced(2) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense possibly damaging 0.79
Big_bend UTSW 15 78565945 missense possibly damaging 0.95
bingo UTSW 15 78564968 missense probably damaging 1.00
Potter UTSW 15 78570743 nonsense probably null
Potter2 UTSW 15 78565454 missense probably damaging 0.97
wheel UTSW 15 78566006 missense probably benign 0.29
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0627:Rac2 UTSW 15 78564968 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R2349:Rac2 UTSW 15 78565475 missense possibly damaging 0.51
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5051:Rac2 UTSW 15 78564934 missense possibly damaging 0.68
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
R7384:Rac2 UTSW 15 78561931 nonsense probably null
R8482:Rac2 UTSW 15 78566006 missense probably benign 0.29
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:40 PM by Anne Murray
Record Created 2017-05-22 8:25 AM by Bruce Beutler
Record Posted 2017-08-11
Phenotypic Description

Figure 1. Lamb mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lamb mice exhibit increased frequencies of peripheral B1b cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Lamb mice exhibit reduced frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lamb phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5051, some of which showed increased frequencies of CD8+ T cells (Figure 1) and B1b cells in B1 cells (Figure 2) with concomitant reduced frequencies of B1a cells in B1 cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the CD8+ T cell phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R5051. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Rac2: a T to C transition at base pair 78,564,934 (v38) on chromosome 15, or base pair 7,850 in the GenBank genomic region NC_000081 encoding the Rac2 gene. The strongest association was found with an additive model of inheritance to the normalized frequency of B1a cells in B1 cells phenotype, wherein 11 variant homozygotes and 24 heterozygous mice departed phenotypically from 12 homozygous reference mice with a P value of 1.398 x 10-5 (Figure 4). Although a substantial semidominant effect was observed in most of the assays, the CD8+ T cell phenotype exhibited strongest linkage with a recessive model of inheritance. 

 

The mutation corresponds to residue 515 in the mRNA sequence NM_009008 within exon 5 of 7 total exons.


 
499 GATGACAAGGACACCATCGAGAAGCTGAAGGAG
121 -D--D--K--D--T--I--E--K--L--K--E-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine to threonine substitution at position 126 (I126T) in the Rac2 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.011).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 5. Protein domains of Rac2. Rac proteins have 5 GTP binding and hydrolysis domains (G-boxes; G1-G5), 2 switch regions, and a C-terminal polybasic region. The amino acid altered in Lamb is indicated. The image is interactive; click to view additional mutations in Rac2.

Rac2 is a member of the Rac subfamily of Rho guanosine triphosphatases (Rho GTPases). Rho GTPases have several conserved domains including five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions (switch I and II), a polybasic domain, and a prenylation site [Figure 5; (1)]. G-boxes function in GDP binding and exhibit GTPase activity (2). In Rac2, these regions correspond to amino acids 10-17 (G1), Thr35 (G2), 57-61 (G3), and 115-118 (G4), and 157-160 (G5). The Rac proteins each have two highly conserved switch regions, switch I (amino acids 27-40) and switch II (amino acids 56-71), situated on either side of the bound nucleotide. Both switch regions are sites of interactions between the Rac proteins and guanine nucleotide exchange factors (GEFs) and guanine nucleotide-dissociation inhibitors (GDIs) as well as with downstream protein targets (3). The polybasic region of Rac2 (RQQKRP; amino acids 183-188) is required for its function as a regulator of NAPDH oxidase.

 

The mutation in Lamb results in an isoleucine to threonine substitution at position 126 (I126T). Amino acid 126 is within an undefined region between the G4 and G5 regions.

 

For more information about Rac2, please see the record for bingo.

Putative Mechanism

Rho GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. Rac2 functions in actin polymerization resulting in lamellopodial extension and membrane ruffling, directed migration, chemotaxis, and superoxide (O2) production in phagocytic cells as well as cytoskeleton organization in red blood cells and osteoclasts (4-9). The Rac proteins regulate leukocyte migration by transducing signals from cell surface receptors (e.g., the Fcγ receptor, formylmethionyl-leucyl-phenylalanine (fMLP) receptor, and β2 integrins) to the actin and microtubule cytoskeletons through cytoplasmic effectors (e.g., tyrosine kinases, scaffolding/adapter proteins, nucleotide exchange proteins, and phosphatases) upon binding of GTP (10).

 

Rac2 is required for B cell development as well as for either B cell receptor (BCR) signal transduction and subsequent calcium mobilization or in determining the efficiency of BCR ligation (11;12). Rac2-deficient (Rac2-/-) mice exhibit a 30% reduction in B cell numbers due mainly be a reduced number of recirculating B lymphocytes in the bone marrow (11). Rac2-/- mice also display a lack of peritoneal B1 and marginal zone B cells (11). In the peripheral blood, Rac2-/- mice had an increase in total leukocyte number including both B and T cells (11). B cell numbers were reduced in the spleen due to a loss of mature and/or marginal zone B cells (11). In humans, mutations in RAC2 are linked to neutrophil (alternatively, phagocytic) immunodeficiency syndrome [NIS; OMIM: #608203; (13-15)] and decreased numbers of peripheral T and B cells. Patients with NIS have severe, recurrent infections, poor wound healing, and exhibit reduced neutrophil migration, azurophilic granule secretion, and superoxide production (13-15).

 

The alterations in the frequencies of peripheral immune cells indicates some loss of Rac2Lamb function; however, some Rac2 function may remain or Rac1 may be compensating for the loss of Rac2 function and/or expression as other Rac2-/--associated phenotypes were not observed in the Lamb mice.

Primers PCR Primer
Lamb_pcr_F: CCAAGTCATTTTACCCAGGCAC
Lamb_pcr_R: AGATCCTGCTCTGCCTTGTG

Sequencing Primer
Lamb_seq_F: TCACACAGCTGGTACAATGGTTG
Lamb_seq_R: TTGTGACCCTCCCGCTAGG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 511 nucleotides is amplified (chromosome 15, - strand):


1   agatcctgct ctgccttgtg accctcccgc taggggggct cttacccccc ttttcctggt
61  gccttgggcg tctttgtccc actccccact gctccctctc actctccact cccccacctc
121 cagtggttcc ctgaggtacg gcaccactgc cccagcaccc ccatcatcct ggtgggtacc
181 aagctggacc ttcgcgatga caaggacacc atcgagaagc tgaaggagaa gaagctggct
241 cccatcacct acccgcaggg cctggcactg gccaaggata ttggtatggg gcttgagctc
301 agagagagag ggtatctggg ggttggaggt gcctgaacac agccttgtct tagcgctatg
361 ctgcatggtc aaactctgtt ctcccaacca ttgtaccagc tgtgtgacct aggctggtcc
421 cttggcctct ctatgcctgt gtttctctgt cacaaaggta taacagcagt gatggcttct
481 gccatgtcag tgcctgggta aaatgacttg g


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong and Bruce Beutler