Phenotypic Mutation 'Lamb'

• Allele: Lamb
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 78,449,134 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Rac2
• Gene Name: Rac family small GTPase 2
• Chromosomal Location: 78,443,369-78,456,983 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013] ; PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Isoleucine changed to Threonine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000036384] [ENSMUSP00000154826]
• AlphaFold: Q05144
• SMART Domains: Protein: ENSMUSP00000036384; Gene: ENSMUSG00000033220; AA Change: I126T

Domain	Start	End	E-Value	Type
RHO	6	179	3.36e-135	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
  (Using ENSMUST00000043214)
• Predicted Effect: probably benign
• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
  (Using ENSMUST00000230952)
• Meta Mutation Damage Score: 0.1368
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Last Updated: 2019-09-04 9:40 PM by Anne Murray
• Record Created: 2017-05-22 8:25 AM by Bruce Beutler
• Record Posted: 2017-08-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009008; MGI:97846

Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (ENU)(3) Chemically induced (other)(1) Gene trapped(2) Radiation induced(2) Targeted(1)

Phenotypic Description

Figure 1. Lamb mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Lamb mice exhibit increased frequencies of peripheral B1b cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Lamb mice exhibit reduced frequencies of peripheral B1a cells in B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1a cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Lamb phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5051, some of which showed increased frequencies of CD8+ T cells (Figure 1) and B1b cells in B1 cells (Figure 2) with concomitant reduced frequencies of B1a cells in B1 cells (Figure 3) in the peripheral blood.

Nature of Mutation

Figure 4. Linkage mapping of the CD8+ T cell phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R5051. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Rac2: a T to C transition at base pair 78,564,934 (v38) on chromosome 15, or base pair 7,850 in the GenBank genomic region NC_000081 encoding the Rac2 gene. The strongest association was found with an additive model of inheritance to the normalized frequency of B1a cells in B1 cells phenotype, wherein 11 variant homozygotes and 24 heterozygous mice departed phenotypically from 12 homozygous reference mice with a P value of 1.398 x 10^-5 (Figure 4). Although a substantial semidominant effect was observed in most of the assays, the CD8+ T cell phenotype exhibited strongest linkage with a recessive model of inheritance. 

The mutation corresponds to residue 515 in the mRNA sequence NM_009008 within exon 5 of 7 total exons.

499 GATGACAAGGACACCATCGAGAAGCTGAAGGAG 121 -D--D--K--D--T--I--E--K--L--K--E-

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine to threonine substitution at position 126 (I126T) in the Rac2 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.011).

Protein Prediction

Figure 5. Protein domains of Rac2. Rac proteins have 5 GTP binding and hydrolysis domains (G-boxes; G1-G5), 2 switch regions, and a C-terminal polybasic region. The amino acid altered in Lamb is indicated. The image is interactive; click to view additional mutations in Rac2.

Rac2 is a member of the Rac subfamily of Rho guanosine triphosphatases (Rho GTPases). Rho GTPases have several conserved domains including five GTP binding and hydrolysis domains (G-boxes; G1-G5), two switch regions (switch I and II), a polybasic domain, and a prenylation site [Figure 5; (1)]. G-boxes function in GDP binding and exhibit GTPase activity (2). In Rac2, these regions correspond to amino acids 10-17 (G1), Thr35 (G2), 57-61 (G3), and 115-118 (G4), and 157-160 (G5). The Rac proteins each have two highly conserved switch regions, switch I (amino acids 27-40) and switch II (amino acids 56-71), situated on either side of the bound nucleotide. Both switch regions are sites of interactions between the Rac proteins and guanine nucleotide exchange factors (GEFs) and guanine nucleotide-dissociation inhibitors (GDIs) as well as with downstream protein targets (3). The polybasic region of Rac2 (RQQKRP; amino acids 183-188) is required for its function as a regulator of NAPDH oxidase.

The mutation in Lamb results in an isoleucine to threonine substitution at position 126 (I126T). Amino acid 126 is within an undefined region between the G4 and G5 regions.

For more information about Rac2, please see the record for bingo.

Putative Mechanism

Rho GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. Rac2 functions in actin polymerization resulting in lamellopodial extension and membrane ruffling, directed migration, chemotaxis, and superoxide (O₂⁻) production in phagocytic cells as well as cytoskeleton organization in red blood cells and osteoclasts (4-9). The Rac proteins regulate leukocyte migration by transducing signals from cell surface receptors (e.g., the Fcγ receptor, formylmethionyl-leucyl-phenylalanine (fMLP) receptor, and β₂ integrins) to the actin and microtubule cytoskeletons through cytoplasmic effectors (e.g., tyrosine kinases, scaffolding/adapter proteins, nucleotide exchange proteins, and phosphatases) upon binding of GTP (10).

Rac2 is required for B cell development as well as for either B cell receptor (BCR) signal transduction and subsequent calcium mobilization or in determining the efficiency of BCR ligation (11;12). Rac2-deficient (Rac2^-/-) mice exhibit a 30% reduction in B cell numbers due mainly be a reduced number of recirculating B lymphocytes in the bone marrow (11). Rac2^-/- mice also display a lack of peritoneal B1 and marginal zone B cells (11). In the peripheral blood, Rac2^-/- mice had an increase in total leukocyte number including both B and T cells (11). B cell numbers were reduced in the spleen due to a loss of mature and/or marginal zone B cells (11). In humans, mutations in RAC2 are linked to neutrophil (alternatively, phagocytic) immunodeficiency syndrome [NIS; OMIM: #608203; (13-15)] and decreased numbers of peripheral T and B cells. Patients with NIS have severe, recurrent infections, poor wound healing, and exhibit reduced neutrophil migration, azurophilic granule secretion, and superoxide production (13-15).

The alterations in the frequencies of peripheral immune cells indicates some loss of Rac2^Lamb function; however, some Rac2 function may remain or Rac1 may be compensating for the loss of Rac2 function and/or expression as other Rac2^-/--associated phenotypes were not observed in the Lamb mice.

Primers

PCR Primer
Lamb_pcr_F: CCAAGTCATTTTACCCAGGCAC
Lamb_pcr_R: AGATCCTGCTCTGCCTTGTG

Sequencing Primer
Lamb_seq_F: TCACACAGCTGGTACAATGGTTG
Lamb_seq_R: TTGTGACCCTCCCGCTAGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 511 nucleotides is amplified (chromosome 15, - strand):

1   agatcctgct ctgccttgtg accctcccgc taggggggct cttacccccc ttttcctggt
61  gccttgggcg tctttgtccc actccccact gctccctctc actctccact cccccacctc
121 cagtggttcc ctgaggtacg gcaccactgc cccagcaccc ccatcatcct ggtgggtacc
181 aagctggacc ttcgcgatga caaggacacc atcgagaagc tgaaggagaa gaagctggct
241 cccatcacct acccgcaggg cctggcactg gccaaggata ttggtatggg gcttgagctc
301 agagagagag ggtatctggg ggttggaggt gcctgaacac agccttgtct tagcgctatg
361 ctgcatggtc aaactctgtt ctcccaacca ttgtaccagc tgtgtgacct aggctggtcc
421 cttggcctct ctatgcctgt gtttctctgt cacaaaggta taacagcagt gatggcttct
481 gccatgtcag tgcctgggta aaatgacttg g

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hirshberg, M., Stockley, R. W., Dodson, G., and Webb, M. R. (1997) The Crystal Structure of Human rac1, a Member of the Rho-Family Complexed with a GTP Analogue. Nat Struct Biol. 4, 147-152.

  2. Bourne, H. R., Sanders, D. A., and McCormick, F. (1991) The GTPase Superfamily: Conserved Structure and Molecular Mechanism. Nature. 349, 117-127.

  3. Yamauchi, A., Marchal, C. C., Molitoris, J., Pech, N., Knaus, U., Towe, J., Atkinson, S. J., and Dinauer, M. C. (2005) Rac GTPase Isoform-Specific Regulation of NADPH Oxidase and Chemotaxis in Murine Neutrophils in Vivo. Role of the C-Terminal Polybasic Domain. J Biol Chem. 280, 953-964.

  4. Gu, Y., Filippi, M. D., Cancelas, J. A., Siefring, J. E., Williams, E. P., Jasti, A. C., Harris, C. E., Lee, A. W., Prabhakar, R., Atkinson, S. J., Kwiatkowski, D. J., and Williams, D. A. (2003) Hematopoietic Cell Regulation by Rac1 and Rac2 Guanosine Triphosphatases. Science. 302, 445-449.

  5. Kalfa, T. A., Pushkaran, S., Mohandas, N., Hartwig, J. H., Fowler, V. M., Johnson, J. F., Joiner, C. H., Williams, D. A., and Zheng, Y. (2006) Rac GTPases Regulate the Morphology and Deformability of the Erythrocyte Cytoskeleton. Blood. 108, 3637-3645.

  6. Itokowa, T., Zhu, M. L., Troiano, N., Bian, J., Kawano, T., and Insogna, K. (2011) Osteoclasts Lacking Rac2 have Defective Chemotaxis and Resorptive Activity. Calcif Tissue Int. 88, 75-86.

  7. Roberts, A. W., Kim, C., Zhen, L., Lowe, J. B., Kapur, R., Petryniak, B., Spaetti, A., Pollock, J. D., Borneo, J. B., Bradford, G. B., Atkinson, S. J., Dinauer, M. C., and Williams, D. A. (1999) Deficiency of the Hematopoietic Cell-Specific Rho Family GTPase Rac2 is Characterized by Abnormalities in Neutrophil Function and Host Defense. Immunity. 10, 183-196.

  8. Yang, F. C., Atkinson, S. J., Gu, Y., Borneo, J. B., Roberts, A. W., Zheng, Y., Pennington, J., and Williams, D. A. (2001) Rac and Cdc42 GTPases Control Hematopoietic Stem Cell Shape, Adhesion, Migration, and Mobilization. Proc Natl Acad Sci U S A. 98, 5614-5618.

  9. Yang, F. C., Kapur, R., King, A. J., Tao, W., Kim, C., Borneo, J., Breese, R., Marshall, M., Dinauer, M. C., and Williams, D. A. (2000) Rac2 Stimulates Akt Activation Affecting BAD/Bcl-XL Expression while Mediating Survival and Actin Function in Primary Mast Cells. Immunity. 12, 557-568.

  10. Wheeler, A. P., Wells, C. M., Smith, S. D., Vega, F. M., Henderson, R. B., Tybulewicz, V. L., and Ridley, A. J. (2006) Rac1 and Rac2 Regulate Macrophage Morphology but are Not Essential for Migration. J Cell Sci. 119, 2749-2757.

  11. Croker, B. A., Tarlinton, D. M., Cluse, L. A., Tuxen, A. J., Light, A., Yang, F. C., Williams, D. A., and Roberts, A. W. (2002) The Rac2 Guanosine Triphosphatase Regulates B Lymphocyte Antigen Receptor Responses and Chemotaxis and is Required for Establishment of B-1a and Marginal Zone B Lymphocytes. J Immunol. 168, 3376-3386.

  12. Walmsley, M. J., Ooi, S. K., Reynolds, L. F., Smith, S. H., Ruf, S., Mathiot, A., Vanes, L., Williams, D. A., Cancro, M. P., and Tybulewicz, V. L. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302, 459-462.

  13. Williams, D. A., Tao, W., Yang, F., Kim, C., Gu, Y., Mansfield, P., Levine, J. E., Petryniak, B., Derrow, C. W., Harris, C., Jia, B., Zheng, Y., Ambruso, D. R., Lowe, J. B., Atkinson, S. J., Dinauer, M. C., and Boxer, L. (2000) Dominant Negative Mutation of the Hematopoietic-Specific Rho GTPase, Rac2, is Associated with a Human Phagocyte Immunodeficiency. Blood. 96, 1646-1654.

  14. Ambruso, D. R., Knall, C., Abell, A. N., Panepinto, J., Kurkchubasche, A., Thurman, G., Gonzalez-Aller, C., Hiester, A., deBoer, M., Harbeck, R. J., Oyer, R., Johnson, G. L., and Roos, D. (2000) Human Neutrophil Immunodeficiency Syndrome is Associated with an Inhibitory Rac2 Mutation. Proc Natl Acad Sci U S A. 97, 4654-4659.

  15. Gu, Y., Jia, B., Yang, F. C., D'Souza, M., Harris, C. E., Derrow, C. W., Zheng, Y., and Williams, D. A. (2001) Biochemical and Biological Characterization of a Human Rac2 GTPase Mutant Associated with Phagocytic Immunodeficiency. J Biol Chem. 276, 15929-15938.