Phenotypic Mutation 'Poseidon2' (pdf version)
AllelePoseidon2
Mutation Type missense
Chromosome8
Coordinate117,577,874 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Plcg2
Gene Name phospholipase C, gamma 2
Synonym(s) Plcg-2, PLCgamma2
Chromosomal Location 117,498,291-117,635,142 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_172285; MGI:97616

Mapped Yes 
Limits of the Critical Region 117498291 - 117635140 bp
Amino Acid Change Isoleucine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000079991]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: I273F

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000081232)
Meta Mutation Damage Score 0.2605 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - decreased 10925250 10933392
FACS B1a cells - decreased
FACS B1a cells in B1 cells - decreased
FACS B1b cells in B1 cells - decreased
FACS B2 cells - increased
FACS CD44+ CD4 T cells - decreased
FACS CD44+ CD8 MFI - decreased
FACS CD44+ CD8 T cells - decreased
FACS CD44+ T cells - decreased
FACS CD8a+ DCs (gated in CD11c+ cells) - increased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
FACS IgM MFI - increased
FACS IgM+ B cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
IgE response to a Cysteine Protease (Papain) - increased
LPS-induced Necroptosis - decreased
Macrophage necroptosis: low
NLRP3 inflammasome: high response
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization 22761313
TLR signaling defect: hypersensitivity to CpG + IFNg
TLR signaling defect: hyposensitivity to R848
Candidate Explorer Status CE: potential candidate; human score: -0.5; ML prob: 0.366
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(20) : Chemically induced (ENU)(3) Gene trapped(10) Spontaneous(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
queen UTSW 8 117581707 missense probably benign 0.00
Seahorse UTSW 8 117589835 splice site probably null
Teleost UTSW 8 117583549 missense probably damaging 1.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
R7036:Plcg2 UTSW 8 117596306 missense probably benign
R7070:Plcg2 UTSW 8 117596306 missense probably benign
R7072:Plcg2 UTSW 8 117589835 splice site probably null
R7214:Plcg2 UTSW 8 117583549 missense probably damaging 1.00
R7351:Plcg2 UTSW 8 117590310 missense possibly damaging 0.95
R7393:Plcg2 UTSW 8 117579825 missense possibly damaging 0.90
R7443:Plcg2 UTSW 8 117504289 missense probably benign 0.00
R7513:Plcg2 UTSW 8 117579853 missense probably damaging 0.99
R7609:Plcg2 UTSW 8 117558113 missense probably benign 0.01
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Mode of Inheritance Autosomal Dominant
Local Stock
Repository
Last Updated 2019-09-04 9:40 PM by Diantha La Vine
Record Created 2017-06-04 10:51 AM by Xue Zhong
Record Posted 2018-04-11
Phenotypic Description

Figure 1. Poseidon2 mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Poseidon2 mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Poseidon2 phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R5226, some of which showed exhibited reduced frequencies of B1 cells in the peripheral blood (Figure 1) as well as diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the diminished T-independent IgM responses to NP-Ficoll using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 62 mutations (X-axis) identified in the G1 male of pedigree R5226. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations. Both of the above anomalies were linked by continuous variable mapping to a mutation in Plcg2:  an A to T transversion at base pair 117,577,874 (v38) on chromosome 8, or base pair 79,600 in the GenBank genomic region NC_000074 encoding Plcg2. The strongest association was found with an additive model of inheritance to the normalized NP-Ficoll-associated phenotype, wherein nine variant homozygotes and 35 heterozygous mice departed phenotypically from 21 homozygous reference mice with a P value of 5.01 x 10-7 (Figure 3). A semidominant effect was observed in both of the assays.

 

The mutation corresponds to residue 1,018 in the mRNA sequence NM_172285 within exon 10 of 33 total exons.

 

1003 CGGATGACCAAGTTTATCGACGACACAATGAGA

268  -R--M--T--K--F--I--D--D--T--M--R-

 

The mutated nucleotide is indicated in red. The mutation results in an isoleucine to phenylalanine substitution at position 273 (I273F) in the phospholipase C gamma 2 (PLC-γ2) protein, and is strongly predicted by Polyphen-2 to be damaging (score = 0.800).

Protein Prediction

Figure 4. Domain structure of PLC-γ2. PLC isozymes contain a conserved domain structure consisting of the catalytic X and Y domains located between EF-hand motifs and a calcium-binding C2 domain. There is a pleckstrin homology (PH) domain at the N-terminus. PLC-γ2 contains an additional PH domain split by two tandem Src homology 2 (SH2) domains and an SH3 domain. The Poseidon2 mutation results in an isoleucine to phenylalanine substitution at position 273. This image is interactive. Other mutations found in PLC-γ2 are noted in red. Click on each allele for more information.

The Plcg2 gene encodes the 1265 amino acid PLC-γ2 that is a member of the PLC family (Figure 4). PLC enzymes act as effector molecules in the signal transduction process by hydrolyzing phosphatidylinositol 4,5 bisphosphate (PIP2) to generate two second messengers, diacylglycerol (DAG) and inositol 1,4,5-triphosphate (IP3). PLC isozymes contain a conserved domain structure consisting of the catalytic X and Y domains located between EF-hand motifs and a calcium-binding C2 domain. Most PLC proteins also contain a pleckstrin homology (PH) domain at their N-terminus. Additional domains are present in some PLC isozymes including the γ subtypes (PLC-γ1 and -γ2), which contain an additional PH domain split by two tandem Src homology 2 (SH2) domains and an SH3 domain (1). The Poseidon2 mutation alters I273 within the EF domain. The effect of the mutation on protein expression and localization has not been determined.  

 

Please see the record for queen for more information about Plcg2.

Putative Mechanism

The hydrolysis of PIP2 by PLC enzymes to produce DAG and IP3 is a critical step in the signal transduction process of many pathways.  DAG is responsible for activating protein kinase C and possibly the TRP calcium influx channels, while IP3 modulates calcium responses within the cell by binding to receptors on the intracellular membrane to allow the mobilization of intracellular calcium (2)Plcg2 -/- mice display internal bleeding, osteopetrosis, impaired lymph node organogenesis and defects in the functioning of B cells, platelets, neutrophils, mast cells, dendritic cells (DCs), macrophages and natural killer (NK) cells (3-5).  A nonsense mutation in Plcg2, resulting in a truncation in the N-terminal PH domain, causes aberrant separation of blood and lymphatic vessels (6).  In addition, two ENU-generated Plcg2 point mutations located in the catalytic and split PH domains have been linked to inflammatory and autoimmune responses through PLC-γ2 hyperactivation in cells of both the innate and acquired immune system (7;8). Plcg2 -/- mice display decreased mature B cells, a block in pro-B cell differentiation, B-1 B cell deficiency, and an absence of T cell-independent (T-I) antibody production; the T cell-dependent responses are relatively normal (3;4).  These phenotypes can be attributed to a defect in BCR and pre-BCR signaling with a concomitant deficiency in B-1 cells; the persistence of some peripheral B-2 cells allows the development of a T-D response. Calcium mobilization via PLC activation can be activated by Toll-like receptor (TLR) signaling (9;10).  TLR signaling pathway culminates in MAPK and NF-κB activation resulting in the production of proinflammatory cytokines (11).  Macrophages and DCs from PLC-γ2 deficient animals display abnormal calcium mobilization and reduced production of proinflammatory cytokines in response to peptidoglycan (PGN), a Gram-positive bacterial cell wall component recognized by TLR2 (see the record for languid), and lipopoysaccharide (LPS), a Gram-negative bacterial component recognized by TLR4 (see the record for lps3) (5). The phenotypes observed in Poseidon2 mice are consistent with those found in Plcg2 -/- mice as well as in mice with deficiencies in other BCR signaling molecules.

Primers PCR Primer
Poseidon2_pcr_F: TATGTGGCTCTGAATGACATAGG
Poseidon2_pcr_R: TGGCGAAACAGGTAATCCCAC

Sequencing Primer
Poseidon2_seq_F: GCTCTGAATGACATAGGTTTGAC
Poseidon2_seq_R: GGTAATCCCACCCAGGTAAGAATCAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 8, + strand):


1   tatgtggctc tgaatgacat aggtttgaca ttgggtccag tctttgatca ccttgactag
61  gtcctgagga ggaccttgcc tgtcctttgg tgactttgtg ttatcttcga catctttaag
121 gagctatggg ctcaggatct gaacaaagtc cgggagcgga tgaccaagtt tatcgacgac
181 acaatgagag agaccgcaga gcccttctta tttgtggatg aggtgagtgg gctggggcat
241 gtcacgtgag caggacttcc tttatccctt cccctcggaa ggtgtcactg tcaggtgtcc
301 gggggactga ctccgtgtaa ggagtggttt tcccagggtg gggattaatc ctgcttttca
361 ttttcctgat tcttacctgg gtgggattac ctgtttcgcc a


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsXue Zhong, Aijie Liu, Jin Huk Choi, and Bruce Beutler