Phenotypic Mutation 'cloudies' (pdf version)
List |< first << previous [record 68 of 132] next >> last >|
Allelecloudies
Mutation Type nonsense
Chromosome10
Coordinate28,761,199 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Themis
Gene Name thymocyte selection associated
Synonym(s) Tsepa, Gasp, E430004N04Rik
Chromosomal Location 28,668,360-28,883,818 bp (+)
MGI Phenotype FUNCTION: This gene encodes a protein that plays a regulatory role in both positive and negative T-cell selection during late thymocyte development. The protein functions through T-cell antigen receptor signaling, and is necessary for proper lineage commitment and maturation of T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mice have defects in T cell positive selection that leads to very few alpha-beta T cells being found in the periphery. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_178666, NM_001305663; MGI:2443552

Mapped Yes 
Limits of the Critical Region 28668360 - 28883818 bp
Amino Acid Change Glutamic Acid changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000060129] [ENSMUSP00000055315] [ENSMUSP00000101155] [ENSMUSP00000123919] [ENSMUSP00000123894]
SMART Domains Protein: ENSMUSP00000060129
Gene: ENSMUSG00000049109
AA Change: E100*

DomainStartEndE-ValueType
Pfam:CABIT 17 266 5.2e-59 PFAM
Pfam:CABIT 282 530 3.7e-48 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000055315
Gene: ENSMUSG00000049109
AA Change: E100*

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9.3e-52 PFAM
Pfam:CABIT 282 532 5e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000101155
Gene: ENSMUSG00000049109
AA Change: E100*

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9e-52 PFAM
Pfam:CABIT 282 532 4.9e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000123919
Gene: ENSMUSG00000049109

DomainStartEndE-ValueType
Pfam:CABIT 17 91 1.9e-10 PFAM
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000123894
Gene: ENSMUSG00000049109

DomainStartEndE-ValueType
Pfam:CABIT 17 86 1.9e-9 PFAM
Pfam:CABIT 129 203 5.1e-18 PFAM
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
Blood Pressure: DBP Day 1 - increased
CD8 response - decreased
CTL killing - decreased
CTL killing dominant epitope - decreased
FACS B:T cells - increased
FACS CD4:CD8 - decreased 19597497
FACS CD4+ T cells - decreased 19597497
FACS CD4+ T cells in CD3+ T cells - decreased 19597497
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 19597497
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased 19597497
FACS naive CD8 T cells in CD8 T cells - decreased 19597497
FACS T cells - decreased
T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(4) Chemically induce (other) (1) Gene trapped(2) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Themis APN 10 28668753 splice site probably benign
IGL01729:Themis APN 10 28761591 nonsense probably null
IGL01833:Themis APN 10 28782311 nonsense probably null
IGL02582:Themis APN 10 28761547 missense probably benign 0.00
IGL02835:Themis APN 10 28761620 intron probably benign
currant UTSW 10 28782011 missense probably damaging 1.00
death_valley UTSW 10 28668727 missense probably damaging 1.00
R0445:Themis UTSW 10 28782011 missense probably damaging 1.00
R0507:Themis UTSW 10 28781832 missense possibly damaging 0.90
R0709:Themis UTSW 10 28761574 missense probably benign 0.00
R1170:Themis UTSW 10 28668748 missense possibly damaging 0.80
R1442:Themis UTSW 10 28782135 missense probably damaging 0.96
R1844:Themis UTSW 10 28781757 missense probably damaging 1.00
R2004:Themis UTSW 10 28782724 missense probably benign 0.28
R2150:Themis UTSW 10 28668727 missense probably damaging 1.00
R2358:Themis UTSW 10 28863380 missense possibly damaging 0.57
R4529:Themis UTSW 10 28782335 missense possibly damaging 0.92
R4693:Themis UTSW 10 28782651 missense probably damaging 1.00
R4717:Themis UTSW 10 28789752 missense probably benign
R4801:Themis UTSW 10 28761511 missense probably benign 0.21
R4802:Themis UTSW 10 28761511 missense probably benign 0.21
R5249:Themis UTSW 10 28761199 nonsense probably null
R5557:Themis UTSW 10 28781886 missense possibly damaging 0.90
R5569:Themis UTSW 10 28781891 missense possibly damaging 0.95
R5640:Themis UTSW 10 28863376 missense probably damaging 0.99
R5735:Themis UTSW 10 28722534 missense probably benign 0.09
R6467:Themis UTSW 10 28781766 missense possibly damaging 0.47
R6523:Themis UTSW 10 28781898 missense possibly damaging 0.65
R6727:Themis UTSW 10 28781907 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-05-15 1:59 PM by Anne Murray
Record Created 2017-06-20 12:32 PM by Xue Zhong
Record Posted 2017-09-07
Phenotypic Description
Figure 1. Cloudies mice exhibit decreased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Cloudies mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Cloudies mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Cloudies mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Cloudies mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Cloudies mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Cloudies mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Cloudies mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Cloudies mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Cloudies mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Cloudies mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Cloudies mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Cloudies mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Cloudies mice exhibit increased CD44 expression on T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Cloudies mice exhibit increased CD44 expression on CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Cloudies mice exhibit increased CD44 expression on CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cloudies phenotype was identified among G3 mice of the pedigree R5249, some of which showed a reduced CD4 to CD8 T cell ratio (Figure 1) and an increased B to T cell ratio (Figure 2). Some mice showed reduced frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), CD8+ T cells (Figure 5), naive CD4 T cells in CD4 T cells (Figure 6), naive CD8 T cells in CD8 T cells (Figure 7) with concomitant increased frequencies of CD4+ T cells in CD3+ T cells (Figure 8), CD44+ CD8 T cells (Figure 9), CD8+ T cells in CD3+ T cells (Figure 10), central memory CD4 T cells in CD4 T cells (Figure 11), central memory CD8 T cells in CD8 T cells (Figure 12), and effector memory CD4 T cells in CD4 T cells (Figure 13), all in the peripheral blood. The expression of CD44 was increased on peripheral blood T cells (Figure 14), CD4 T cells (Figure 15), and CD8 T cells (Figure 16). Some mice showed defective cytotoxic T lymphocyte-mediated target cell killing (Figure 17).

Nature of Mutation

Figure 18. Linkage mapping of the increased CD44 expression on CD4 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 95 mutations (X-axis) identified in the G1 male of pedigree R5249. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 95 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Themis:  a G to T transversion at base pair 28,761,199 (v38) on chromosome 10, or base pair 92,873 in the GenBank genomic region NC_000076 encoding Themis. The strongest association was found with a recessive model of inheritance to the normalized expression of CD44 on peripheral blood CD4 T cells, wherein five variant homozygotes departed phenotypically from 32 homozygous reference mice and 26 heterozygous mice with a P value of 3.783 x 10-27 (Figure 18). A substantial semidominant effect was observed in most of the assays, but the mutation is preponderantly recessive; a purely dominant effect observed was not observed in any assays. 

 

The mutation corresponds to residue 598 in the mRNA sequence NM_178666 within exon 3 of 6 total exons.


 
583 CCATACCTGTCAATTGAAGAAATCACAAGAACC
95  -P--Y--L--S--I--E--E--I--T--R--T-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamic acid 100 for a premature stop codon (E100*) in the Themis protein.

Protein Prediction
Figure 19. Domain structure of Themis. The cloudies mutation (E100*) is shown. Abbreviations: CABIT, cysteine-containing all beta in Themis; NLS, nuclear localization signal; PRR, proline-rich region. See text for more details. This image is interactive; click to view other mutations in Themis.

Themis encodes Thymocyte expressed molecule involved in selection [Themis; alternatively, Grb2-associating protein (Gasp)]. Themis contains two CABIT (cysteine-containing all beta iThemis) domains (amino acids 1-261 (CABIT1) and 262-521 (CABIT2) in Themis), a bipartite nuclear localization signal (NLS; amino acids 345-349 in Themis), and a proline-rich region (PRR; PPPRPPKHP; amino acids 555-563 in Themis) [Figure 19(1-3)]. The cloudies mutation results in substitution of glutamic acid 100 for a premature stop codon (E100*) in the Themis protein; amino acid 100 is within the CABIT1 domain.

 

For more information about Themis, please see the record for currant.

Putative Mechanism

Themis functions at the positive selection checkpoint in thymocyte development; its mode of action is not known (1-5). Several Themis mutant mouse strains exhibited a block in positive selection, resulting in a block in the developmental progression from DP to SP cells (1-6). As a result, the mutant mice exhibited reduced numbers of thymic and peripheral CD4 and CD8 SP cells; the CD4 SP cells were more affected than the CD8 SP cell population (1-6). The role of Themis in negative selection is unclear. In several mutant mouse studies, minor defects in negative selection were observed along with defects in positive selection (1;4). The function of Themis in TCR signaling has not been resolved. Studies have reported a constitutive association of Themis with TCR signaling proteins including Vav1 (1), Itk, and PLCγ1 (4;6;7). In addition, several studies determined that, upon TCR stimulation, Themis associated with PLCγ1, LAT, and SLP-76 indicating that Themis may be a component of the SLP-76/LAT signalosome (1;4;6-8). Mutations in the noncoding region between THEMIS and PTPRK have been linked to susceptibility to celiac disease in humans (9). In addition, patients with celiac disease exhibit elevated THEMIS levels in the duodenal mucosa compared to unaffected individuals (10). Mice with mutations or deficiency in Themis phenocopy the cloudies mice in that all of the models exhibit reduced frequencies of peripheral CD4 and CD8 SP cells compared to wild-type mice (1-4;10), suggesting that the cloudies mutation is hypomorphic.  Thymocyte positive selection is likely defective in cloudies mice, as shown for other Themis mutants.

Primers PCR Primer
cloudies(F):5'- GCACACTTATGTCTACACACATGC -3'
cloudies(R):5'- CCTTCTTGTGACAATGGCAAAG -3'

Sequencing Primer
cloudies_seq(F):5'- TTCCTACGAGAACTTTCATTA -3'
cloudies_seq(R):5'- AAATGAGTGGCTCTGATGATTCC -3'
References
  9. Dubois, P. C., Trynka, G., Franke, L., Hunt, K. A., Romanos, J., Curtotti, A., Zhernakova, A., Heap, G. A., Adany, R., Aromaa, A., Bardella, M. T., van den Berg, L. H., Bockett, N. A., de la Concha, E. G., Dema, B., Fehrmann, R. S., Fernandez-Arquero, M., Fiatal, S., Grandone, E., Green, P. M., Groen, H. J., Gwilliam, R., Houwen, R. H., Hunt, S. E., Kaukinen, K., Kelleher, D., Korponay-Szabo, I., Kurppa, K., MacMathuna, P., Maki, M., Mazzilli, M. C., McCann, O. T., Mearin, M. L., Mein, C. A., Mirza, M. M., Mistry, V., Mora, B., Morley, K. I., Mulder, C. J., Murray, J. A., Nunez, C., Oosterom, E., Ophoff, R. A., Polanco, I., Peltonen, L., Platteel, M., Rybak, A., Salomaa, V., Schweizer, J. J., Sperandeo, M. P., Tack, G. J., Turner, G., Veldink, J. H., Verbeek, W. H., Weersma, R. K., Wolters, V. M., Urcelay, E., Cukrowska, B., Greco, L., Neuhausen, S. L., McManus, R., Barisani, D., Deloukas, P., Barrett, J. C., Saavalainen, P., Wijmenga, C., and van Heel, D. A. (2010) Multiple Common Variants for Celiac Disease Influencing Immune Gene Expression. Nat Genet. 42, 295-302.
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsXue Zhong, Aijie Liu, Bruce Beutler
List |< first << previous [record 68 of 132] next >> last >|