Phenotypic Mutation 'noelle' (pdf version)
List |< first << previous [record 43 of 74] next >> last >|
Allelenoelle
Mutation Type critical splice donor site
Chromosome2
Coordinate165,063,563 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Cd40
Gene Name CD40 antigen
Synonym(s) Bp50, Cd40, p50, Tnfrsf5
Chromosomal Location 165,055,627-165,072,948 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011611NM_170703NM_170704NM_170702; MGI:88336

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000017799] [ENSMUSP00000073386] [ENSMUSP00000080059] [ENSMUSP00000122981] [ENSMUSP00000138707] [ENSMUSP00000139193]
SMART Domains Protein: ENSMUSP00000017799
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000073386
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000080059
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000122981
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TNFR 64 97 9.45e-6 SMART
Blast:TNFR 100 121 1e-8 BLAST
Predicted Effect probably benign
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000139193
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS effector memory CD4 T cells in CD4 T cells - decreased
FACS effector memory CD8 T cells in CD8 T cells - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
total IgE level - decreased 11418692
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(11) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(8) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
bluebonnet UTSW 2 165062301 missense probably benign 0.23
R0553:Cd40 UTSW 2 165070741 missense probably benign 0.01
R1115:Cd40 UTSW 2 165070761 missense possibly damaging 0.59
R1134:Cd40 UTSW 2 165070818 missense probably benign 0.44
R2036:Cd40 UTSW 2 165062301 missense probably benign 0.23
R2938:Cd40 UTSW 2 165069702 missense probably benign 0.01
R3034:Cd40 UTSW 2 165062315 missense probably benign 0.02
R4690:Cd40 UTSW 2 165069695 missense possibly damaging 0.68
R5222:Cd40 UTSW 2 165066544 missense probably benign 0.41
R5310:Cd40 UTSW 2 165063563 critical splice donor site probably null
Z1088:Cd40 UTSW 2 165063040 missense probably damaging 0.96
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-08-30 12:00 PM by Anne Murray
Record Created 2017-06-22 10:29 AM by Bruce Beutler
Record Posted 2017-08-18
Phenotypic Description

Figure 1. Noelle mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The noelle phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5310, some of which showed a diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1). 

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG responses to ovalbumin administered with aluminum hydroxide using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R5310. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. The diminished T-dependent antibody response phenotype was linked by continuous variable mapping to a mutation in Cd40:  a T to C transition at base pair 165,063,563 (v38) on chromosome 2, or base pair 7,956 in the GenBank genomic region NC_000068 within the donor splice site of intron 5.  Linkage was found with a recessive model of linkage, wherein six variant homozygotes departed phenotypically from eight homozygous reference mice and 16 heterozygous mice with a P value of 6.612 x 10-11 (Figure 2).  A substantial semidominant effect was also observed (P = 5.564 x 10-7). 

 

The effect of the mutation at the cDNA and protein level has not examined, but the mutation is predicted to result in the use of a cryptic site in intron 5. The resulting transcript would have a 34-nucleotide insertion of intron 5, which would cause a frame shifted protein product beginning after amino acid 165 of the protein, which is normally 289 amino acids in length, and premature termination after the inclusion of 13 aberrant amino acids.


 

C57BL/6J:

           <--exon 4     <--exon 5 intron 5-->      exon 6-->            <--exon 9

7549 ……GTTATGGAGATGG ……CCCTGGACAAG gtataagggtcacc…… CTGTGAGGATAAG…… ……CCCCTGGTCTGA
131  ……-V--M--E--M-- ……-P--W--T--S                  --C--E--D--K-…… ……-P--L--V--*- 289

 

The donor splice site of intron 5, which is destroyed by the noelle mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain organization of CD40. The effect of the noelle mutation is indicated. Abbreviations: SP, signal peptide; CRD, cysteine-rich domain; TM, transmembrane domain; cyt-N, cytoplasmic N-terminal; cyt-C, cytoplasmic C-terminal.

CD40 (alternatively, TNFRSF5) is a member of the tumor necrosis factor receptor (TNFR) family that also includes Fas (alternatively, TNFR6; see the record for cherry) and lymphotoxin β receptor (LTβR; see the record for kama). Similar to other members of the TNFR family, CD40 is a single-pass transmembrane-spanning protein with an extracellular domain (ECD; amino acids 24-193; SMART), a transmembrane domain (TMD; amino acids 193-215), and an intracellular domain (ICD; amino acids 216-289) [Figure 3(1)]. Amino acids 1-23 of CD40 comprise a signal peptide.

 

For more information about Cd40, please see the record for bluebonnet.

Putative Mechanism

The CD40 receptor, expressed on B cells and other APCs, is engaged by CD40L (see the entry for walla) that is present primarily on activated T cells. The canonical and non-canonical NF-κB signaling pathways are activated downstream of TRAFs upon CD40L:CD40 engagement, and are major pathways for transducing the effects of CD40 activation. CD40 signaling is essential for the maturation and survival of DCs, resulting in enhanced survival, secretion of cytokines such as interleukin (IL)-1, IL-6, IL-8, IL-10, IL-12, and TNFα, and upregulation of costimulatory molecules including ICAM-1, LFA-3, CD80, and CD86.  CD40 induces B cell proliferation (2-4), cell-cell adhesion (5), differentiation (6;7), and tyrosine phosphorylation (8;9); B cells receive a critical costimulatory signal from T cells through CD40. Mutations in CD40 are linked to the autosomal recessive form of immunodeficiency with hyper-IgM [HIGM3; OMIM: #606843); (10-12)].  HIGM syndromes, including HIGM1 (caused by mutations in CD40LG) and HIGM2 (caused by mutations in AID) are characterized by normal to elevated levels of IgM and low levels of IgA, IgG, and IgE, the absence of GCs, and the inability to mount a T-dependent humoral response [reviewed in (13)]. Cd40-deficient (Cd40-/-) mice were deficient in mounting an antigen-specific antibody response or to develop GCs after immunization with T-dependent antigen keyhole limpet hemocyanin (KLH) (14). The T-independent antibody response to 2,4,6-trinitrophenyl-conjugated lipopolysaccharide (TNP-LPS) and TNP-Ficoll in the Cd40-/- mice were normal (14). The loss in T-dependent antibody responses observed in the noelle mice indicates a loss of CD40noelle function including a failure to develop GCs in response to T-dependent antigen immunization.

Primers PCR Primer
noelle(F):5'- TGCCTTGGGGTAAGAAGCTG -3'
noelle(R):5'- CCAACAGGCTTCTATTAACTAAGC -3'

Sequencing Primer
noelle_seq(F):5'- AGGTGTTCTGTCCTGCCCTG -3'
noelle_seq(R):5'- CAGGCTTCTATTAACTAAGCAGAAG -3'
References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsJin Huk Choi and Bruce Beutler
List |< first << previous [record 43 of 74] next >> last >|