Phenotypic Mutation 'wobble'

• Allele: wobble
• Mutation Type: missense
• Chromosome: 13
• Coordinate: 59,622,364 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Agtpbp1
• Gene Name: ATP/GTP binding protein 1
• Synonym(s): 2310001G17Rik, Ccp1, Nna1, 4930445M19Rik, 1700020N17Rik, 2900054O13Rik, 5730402G09Rik, atms
• Chromosomal Location: 59,597,348-59,705,184 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002] ; PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Aspartic acid changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000022040] [ENSMUSP00000130939] [ENSMUSP00000127600] [ENSMUSP00000132854] [ENSMUSP00000128589 ^†] [ENSMUSP00000153569] † probably from a misspliced transcript
• AlphaFold: Q641K1
• SMART Domains: Protein: ENSMUSP00000022040; Gene: ENSMUSG00000021557; AA Change: D954V

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	851	1099	1.7e-13	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000022040)
• SMART Domains: Protein: ENSMUSP00000126238; Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
low complexity region	250	279	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000130939; Gene: ENSMUSG00000021557; AA Change: D954V

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	847	1123	1.2e-26	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000164215)
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000128589; Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.4e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
low complexity region	787	795	N/A	INTRINSIC

• Predicted Effect: probably benign
• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000224397)
• Meta Mutation Damage Score: 0.9738
• Is this an essential gene?: Probably essential (E-score: 0.815)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-06-29 11:38 AM
• Record Posted: 2018-04-20
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer, Sohini Mukherjee, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_023328 (isoform 1), NM_001048008 (isoform 2), NM_001284218 (isoform 3), NM_001284219 (isoform 4), NM_001284221 (isoform 5); MGI: 2159437

Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(5) Chemically induced (other)(1) Gene trapped(7) Spontaneous(7) Transgenic(1)

Phenotypic Description

Figure 1. Wobble mice exhibited reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Wobble mice exhibited reduced times on a rotarod. Normalized data from gene-based superpedigree analysis of mutations in Agtpbp1 in pedigrees R5066 and R5352 are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The wobble phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5066, some of which showed smaller body weights than wild-type littermates (Figure 1). Some mice also exhibited reduced times on a rotarod (Figure 2; gene-based superpedigree analysis of mutations in Agtpbp1 in pedigrees R5066 and R5352).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R5066. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. Both of the above anomalies were linked to mutations in two genes on chromosome 13: Syk and Agtbp1. The mutation in Agtpbp1 was presumed to be causative as the wobble neurological and body weight phenotypes mimic other known alleles of Agtpbp1 (see MGI for a list of Agtpbp1 alleles as well as the entries for drunk and rio). The mutation in Agtpbp1 is an A to T transversion at base pair 59,474,550 (v38) on chromosome 13, or base pair 82,817 in the GenBank genomic region NC_000079 encoding Agtpbp1. Linkage was found with a recessive model of inheritance (P = 0.000106; body weight phenotype), wherein one variant homozygote departed phenotypically from nine homozygous reference mice and 16 heterozygous mice (Figure 2).

The mutation corresponds to residue 3,019 in the NM_023328 mRNA sequence in exon 21 of 26 total exons.

3003 CCCATGCTAAATCCAGATGGTGTCATCAATGGA 949  -P--M--L--N--P--D--G--V--I--N--G-

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to valine substitution at position 954 (D954V) in the Nna1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain structure of NNA1. The wobble mutation results in an aspartic acid to valine substitution at position 954 of the Nna1 protein. Click on each mututation in red for more specific information.

The Agtpbp1 gene encodes Nna1, which has a number of predicted protein domains and motifs (1). The most prominent feature of Nna1 is the presence of a zinc carboxypeptidase-like sequence located within a highly conserved 300-amino acid region towards the C-terminus. This 300-amino acid region is 96% identical in mice and humans. The carboxypeptidase domain of Nna1 contains a zinc-binding motif, which is characterized by two conserved histidines and a catalytic glutamate residue, at positions H912, E915 and H1009 in Nna1. In this region, there are also consensus sequences for a tyrosine phosphorylation site, nuclear localization signal, and an ATP/GTP binding motif of the P-loop type. In the rest of the protein, there are several more predicted tyrosine phosphorylation sites, one nuclear localization signal, and consensus phosphorylation sites for protein kinase C, casein kinase II and cGMP/cAMP-dependent kinases. The N-terminal 450 amino acids of Nna1 are leucine-rich and possess weak homology to armadillo repeat proteins. The mutation results in an aspartic acid to valine substitution at position 954 (D954V) in the Nna1 protein; residue 954 is within the conserved region.

Please see the record drunk for more information about the Agtpbp1 gene.

Putative Mechanism

Agtpbp1 is also mutated in the spontaneously occurring pcd (Purkinje cell degeneration) mutants. There are currently eight known phenotypic alleles of pcd, out of which four have identified genetic lesions. The hallmark feature of pcd mice is development of an ataxic gait between three and four weeks of age, which correlates with the onset of cerebellar Purkinje cell degeneration (2). Purkinje cells proceed to deteriorate rapidly and die over the subsequent two week period. Distinct areas of the cerebellum display different rates of Purkinje cell degeneration, but all eventually die. In addition to Purkinje cells, cerebellar granule cells also display progressive death, with near normal numbers at three months declining to 5% by 20 months of age. 

Primers

PCR Primer
wobble_pcr_F: AGTCTGACGCATTACCCACC
wobble_pcr_R: GAGTTCTAGAACCCCAAAGTGAAG

Sequencing Primer
wobble_seq_F: TGACGCATTACCCACCAAAAACTTG
wobble_seq_R: GCACAAGTCAATTTTTGTAGCTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 419 nucleotides is amplified (chromosome 13, - strand):

1   gagttctaga accccaaagt gaagcacaag tcaatttttg tagctgttca ttttaattga
61  gcttttgtgt gcgctttagg aactcgccct tatattttct tgtctgctcg ggtccatcct
121 ggagaaacca atgcaagctg ggtaatgaaa ggaacactgg agtacctcat gagcaatagc
181 ccgactgccc agagcctacg ggagtcttac atttttaaaa ttgtccccat gctaaatcca
241 gatggtgtca tcaatggaaa gtaagttaag cagtggctgc cggagtgcca taggttggga
301 tagttggctg catttaattt gttcatctaa tagtgttcaa gttaattcaa ataatgggtt
361 tgatgatttt ttttctagga aaaaaactcc caagtttttg gtgggtaatg cgtcagact

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

   1.  Harris, A., Morgan, J. I., Pecot, M., Soumare, A., Osborne, A., and Soares, H. D. (2000) Regenerating motor neurons express Nna1, a novel ATP/GTP-binding protein related to zinc carboxypeptidases, Mol. Cell Neurosci. 16, 578-596.

   2.  Mullen, R. J., Eicher, E. M., and Sidman, R. L. (1976) Purkinje cell degeneration, a new neurological mutation in the mouse, Proc. Natl. Acad. Sci. U. S. A 73, 208-212.