Phenotypic Mutation 'damselfly' (pdf version)
List |< first << previous [record 32 of 132] next >> last >|
Alleledamselfly
Mutation Type nonsense
Chromosome18
Coordinate37,897,550 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Diaph1
Gene Name diaphanous related formin 1
Synonym(s) Drf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
Chromosomal Location 37,843,601-37,935,476 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001305980 (variant 1), NM_007858 (variant 2), NM_001305981 (variant 3); MGI:1194490

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025337] [ENSMUSP00000078942] [ENSMUSP00000111292] [ENSMUSP00000111294] [ENSMUSP00000111297]
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456
AA Change: E293*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456
AA Change: E284*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456
AA Change: E249*

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456
AA Change: E249*

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456
AA Change: E284*

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1a cells in B1 cells - decreased
FACS CD4:CD8 - decreased
FACS CD4+ T cells - decreased 17682067
FACS CD4+ T cells in CD3+ T cells - decreased 17682067
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased
IgA response to 2nd OVA/Alum Challenge (day 7) - increased
MCMV susceptibility
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(112) : Gene trapped(107) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
cucamonga UTSW 18 37896093 critical splice donor site
devastator UTSW 18 37896093 critical splice donor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
sheer UTSW 18 37896093 critical splice donor site probably null
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 intron probably null
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-24 4:43 PM by Diantha La Vine
Record Created 2017-07-01 1:13 PM by Bruce Beutler
Record Posted 2017-08-11
Phenotypic Description

Figure 1. Damselfly mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Damselfly mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Damselfly mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Damselfly mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Damselfly mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Damselfly mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Damselfly mice exhibit increased frequencies of peripheral effector memory CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Damselfly mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Damselfly mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Damselfly mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Damselfly mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Damselfly mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Damselfly mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The damselfly phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5294, some of which showed reduced frequencies of CD4+ T cells (Figure 1), naive CD4 T cells in CD4 T cells (Figure 2), and naive CD8 T cells in CD8 T cells (Figure 3) with concomitant increased frequencies of CD44+ T cells (Figure 4), CD44+ CD4 T cells (Figure 5), central memory CD4 T cells in CD4 T cells (Figure 6), effector memory CD4 T cells in CD4 T cells (Figure 7), CD44+ CD8 T cells (Figure 8), central memory CD8 T cells in CD8 T cells (Figure 9), and effector memory CD8 T cells in CD8 T cells (Figure 10). Some mice showed increased CD44 expression on peripheral blood T cells (Figure 11), CD4 T cells (Figure 12), and CD8 T cells (Figure 13).

Nature of Mutation

Figure 14. Linkage mapping of the naive CD8 T cells in CD8 T cells phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 75 mutations (X-axis) identified in the G1 male of pedigree R5294. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 75 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations in Diaph1. The nonsense mutation was presumed causative: a G to T transversion at base pair 37,897,550 (v38) on chromosome 18, or base pair 38,085 in the GenBank genomic region NC_000084 encoding Diaph1. The strongest association was found with a recessive model of inheritance to the normalized naïve CD8 T cells in CD8 T cells phenotype, wherein six variant homozygotes and 14 heterozygous mice departed phenotypically from 22 homozygous reference mice with a P value of 2.204 x 10-20 (Figure 14).

 

The mutation corresponds to residue 1,035 in the mRNA sequence NM_001305980 within exon 9 of 28 total exons.

 

1020 GAAATGGATGAGGTCGAACGCTTCCAGCCACTT
288  -E--M--D--E--V--E--R--F--Q--P--L-
 

The mutated nucleotide is indicated in red.  The mutation results in a substitution of glutamic acid 293 to a premature stop codon (E293*) in the mDia1 protein.

Protein Prediction
Figure 15. Domain and crystal structure of mDia1. (A) Dia consists of the formin homology domains 1 and 2 (FH1, FH2), Rho-binding domain (RBD), a Dia inhibitory domain (DID), dimerization domain (DD), a predicted coiled-coil region (CC) and a dia autoregulatory domain (DAD). The DID, DD, and CC are also referred to as FH3. The location of the damselfly mutation is indicated. This image is interactive; click to view other mutations in Diaph1. (B) Crystal structure of the tetrameric N+C mDia1 complex. Selected domains and subdomains are labeled. The crystal structure was generated by UCSF Chimera and is modeled after PDB:3O4X and Nezami et al (2010). Click to rotate the crystal structure.

Diaph1 encodes mammalian diaphanous-related formin 1 (mDia1; alternatively, mDia or Drf1), a member of the mDia family of formins that is ubiquitously expressed. mDia1 has several domains, including a GTPase-binding domain (GBD), a formin homology 3 (FH3; alternatively, diaphanous inhibitory domain [DID]) domain, a dimerization domain (DD), a coiled-coil, a FH1 domain, a FH2 domain and a diaphanous autoregulatory domain (DAD) (Figure 15). The damselfly mutation results in a substitution of glutamic acid 293 to a premature stop codon (E293*); residue 293 is witin the FH3 domain. The GBD and FH3 domains bind to the DAD domain to keep mDia1 in an inactive conformation (1;2).

 

For more information about Diaph1, please see the record for Guangzhou.

Putative Mechanism

The formins are Rho effectors that direct actin assembly in several processes, such as cytokinesis, cell migration, and establishment and maintenance of cell polarity. mDia1 specifically functions in actin assembly, stress fiber and filopodia formation, phagocytosis, activation of serum response factor, and formation of adherens juctions. mDia1 has several functions in actin assembly, including regulating de novo nucleation, the rate of filament elongation, and filament growth duration before capping (3).

 

Segregation of T and B cells in the spleen and lymph nodes were normal in the Diaph1-/- mice, but the frequencies of both CD4 and CD8 T cells in the spleen and lymph nodes were reduced compared to wild-type mice. The frequencies of B cells, CD11c+ dendritic cells, and CD11b+ dendritic cells were not changed. The number of T cells was reduced in the peripheral blood; however, the numbers of CD4CD8, CD4+CD8+, CD4+CD8, and CD4CD8+ T cells in the thymus were similar to that in wild-type mice. The numbers of CD69loCD62Lhi CD4 or CD8 single-positive T cells was higher indicating that there was an impaired egression of mature T cells from the thymus in the Diaph1-/- mice. With age (greater than postnatal day 300), the Diaph1-/ mice often developed dermatoses and/or alopecia (4). In addition, the Diaph1-/- mice developed splenomegaly, fibrotic and hypercellular bone marrow, extramedullary hematopoiesis in both spleen and liver. Also, the Diaph1-/ mice had immature myeloid progenitor cells with high nucleus-to-cytoplasm ratios. The immune phenotypes observed in the damselfly mice indicate that mDia1damselfly exhibits loss of function.

Primers PCR Primer
damselfly(F):5'- AGCAAAGCCCTACATTTATTTCCC -3'
damselfly(R):5'- ACCGCATGTCATGTGCATTG -3'

Sequencing Primer
damselfly_seq(F):5'- TTTCCCATACCACAGAGAAATGAAGG -3'
damselfly_seq(R):5'- TCAGATGGTCCTTAAAAAGTCAGAG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong and Bruce Beutler
List |< first << previous [record 32 of 132] next >> last >|