Allele | Derek | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 145,930,587 bp (GRCm38) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | A ⇒ G (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Bcl10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | B cell leukemia/lymphoma 10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | mE10, cE10, BCL-10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 145,922,804-145,934,356 bp (+) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016] PHENOTYPE: About one-third of homozygous null embryos die exhibiting exencephaly. Surviving mutants display immunological defects including severe immunodeficiency, abnormal B cell development and function, and impaired humoral response to bacterial infection. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Aspartic acid changed to Glycine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000029842] | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q9Z0H7 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000029842 Gene: ENSMUSG00000028191 AA Change: D80G
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99) |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.9072 ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) ![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | CE: excellent candidate; Verification probability: 0.907; ML prob: 0.852; human score: -0.5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(8) : Gene trapped(5) Radiation induced(1) Targeted(2) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2022-04-12 3:40 PM by External Program | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2017-07-06 8:53 AM by Bruce Beutler | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2018-04-25 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The derek phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5301, some of which showed reduced frequencies B1 cells (Figure 1) with concomitant increased frequencies of T cells (Figure 2), CD4+ T cells (Figure 3), CD44+ T cells (Figure 4), CD44+ CD4 T cells (Figure 5), all in the peripheral blood. CD44 expression was increased on the surface of peripheral blood T cells (Figure 6), CD4+ T cells (Figure 7), and CD8+ T cells (Figure 8). IgM expression was increased on the surface of peripheral blood B cells (Figure 9). Some mice exhibited increased levels of IgE in the serum (Figure 10). Serum levels of total IgE (Figure 11) and OVA-specific IgE (Figure 12) were elevated after administration of ovalbumin compared to that in wild-type mice. The T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 13) and the T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) were also diminished compared to that in wild-type littermates (Figure 14). |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Bcl10: an A to G transition at base pair 145,930,587 (v38) on chromosome 3, or base pair 6,326 in the GenBank genomic region NC_000069 encoding Bcl10. The strongest association was found with a recessive model of inheritance to the normalized total IgE levels (without ovalbumin administration), wherein three variant homozygotes departed phenotypically from 19 homozygous reference mice and 28 heterozygous mice with a P value of 5.541 x 10-47 (Figure 15). The reduced B1 cell frequency and CD4+ T cell phenotypes were found with an additive model of inheritance, but the mutation is preponderantly recessive.
The mutation corresponds to residue 436 in the mRNA sequence NM_009740 within exon 2 of 3 total exons.
The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 80 (D80G) in the Bcl10 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
BCL10 (B cell lymphoma 10) has a caspase recruitment domain (CARD) domain at its N-terminus and a Ser/Thr-rich region at the C-terminus. The BCL10 CARD domain mediates the interaction with the CARD domain of CARMA1 (see the record for king) and with the immunoglobulin-like domains of MALT1 (mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase; see the record for mousebird) (1). The BCL10 CARD domain is unstructured and dynamic when not bound to CARMA1; however, when bound to CARMA1, it aggregates and forms stable filaments (2;3). The Ser/Thr-rich region of BCL10 interacts with the Ig-like domains of MALT1 (4). The function of the CARMA1/BCL10/MALT1 complex is detailed in the “Background” section, below.
BCL10 undergoes several posttranslational modifications upon antigen receptor stimulation as well as after PMA, PMA and ionomycin, or UV treatment [reviewed in (5)]. BCL10 is a substrate of MALT1, which cleaves its substrates after arginine residues. BCL10 is ubiquitinated by TRAF6, which putatively recruits the IKK complex via IKKγ, subsequently promoting further IKK activation by TRAF6-dependent ubiquitination (6;7). BCL10 can be phosphorylated by several kinases, which can either positively or negatively regulate the BCL10 function. IKK-mediated phosphorylation of BCL10 (specific residues have not been identified) promotes CARMA1/BCL10/MALT1 complex stability. IKK-mediated phosphorylation of Thr81 and Ser85 promotes BCL10 ubiquitination by the β-TrCP E3 ligase and subsequent targeting of BCL10 for lysosomal or proteasomal degradation (8;9). IKK-mediated phosphorylation of serines 134, 136, 138, 141, and 144 after TCR stimulation causes dissociation from MALT1 (10). Ca2+–calmodulin-dependent protein kinase II (CaMKII)-mediated phosphorylation of Ser138 after stimulation with PMA and ionomycin attenuates NF-κB-associated signaling as well as regulates the interactions with CARMA1 and MALT1 and the signal-induced ubiquitination of BCL10 (11-14). Phosphorylation of Ser138 by an unidentified kinase promotes BCL10-associated actin polymerization in T cells, monocytes, and macrophages (15). RIP2-mediated phosphorylation of BCL10 (specific residues have not been identified) after TCR stimulation induces positive regulation of NF-κB activation (16). AKT-mediated phosphorylation of serines 218 and 231 promote binding to the IκB family member BCL3 (see the record for sunrise) and the subsequent nuclear accumulation of BCL10 after TNFα (see the record for Panr1) stimulation (17;18).
The derek mutation results in an aspartic acid to glycine substitution at position 80 (D80G) in the BCL10 protein; amino acid 80 is within the CARD domain. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | BCL10 is ubiquitously expressed [reviewed in (5)]. CARMA1 binding to BCL10 promotes the translocation of BCL10 from the cytoplasm to the nucleus (19). At the perinuclear region, BCL10 accumulation mediates nuclear NF-κB activation (20). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
NF-κB controls the proliferation, differentiation and survival of B and T cells by activating the transcription of target genes, including various cytokines. In unstimulated cells, NF-κB is sequestered in the cytoplasm by the inhibitory protein IκB, which binds to NF-κB and prevents its translocation to the nucleus. Stimulation of B cell receptors (BCR) or T cell receptors (TCR) together with costimulatory molecules leads to the activation of IκB kinase (IKK) to phosphorylate IκB, triggering the ubiquitination and degradation of IκB, ultimately resulting in activation of NF-κB by releasing it for translocation to the nucleus. BCR or TCR engagement results in the formation of a lipid raft-associated multiprotein complex (called the “immunological synapse” in T cells) at the site of cell-cell contact that controls the events leading to activation of NF-κB (21). Scaffold proteins are essential for the formation of these complexes, promoting the coordinated receptor- and cell-specific assembly of signaling molecules.
Upon T cell activation by TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (22-25) (8;11-13). The CARMA1/Bcl10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (26).
The phenotypes of CARMA1, Bcl10, MALT1, PKCβ, and PKCθ mutant mice, or cells derived from these mice, provide support for the intermolecular interactions between these proteins revealed by studies in B and T cell lines. For example, PKCβ-/- mice display selective loss of peritoneal B1 cells and reduced immunoglobulin levels (27). Both Bcl10-/- and MALT1-/- mice have increased DN4 relative to DN3 cells, and reduced basal levels of immunoglobulins (28;29). B cells from Bcl10-/- mice and T cells from PKCθ-/- mice fail to proliferate in response to BCR or TCR activation, respectively (28;30). Importantly, primary B or T cells from CARMA1, Bcl10, MALT1, PKCβ, and PKCθ mutants all exhibit impaired NF-κB and JNK activation induced by either PMA/ionomycin or antigen receptor ligation (23;28;29;31-34). These findings support the conclusion that CARMA1, Bcl10, MALT1 and PKC function in the same pathway (in a complex at the immunological synapse), to activate NF-κB in response to antigen receptor stimulation. Bcl10-/- mice also show reduced IgG and IgM levels after injection of vesicular stomatitis virus (28). The Bcl10-/- mice showed defective antibody responses to both T cell-independent and T cell-dependent antigens (35).
BCL10 functions in NF-κB-independent actin and membrane remodeling as well as endosomal trafficking downstream of the FcR in macrophages (36). BCL10 interacts with the clathrin adaptors AP1 and EpsinR, which are required for completion of phagosome closure. The binding of BCL10 and AP1 facilitates the delivery of the PI(4,5)P2 phosphatase OCRL1 to nascent phagocytic cups, subsequently regulating F-actin dynamics. Loss of BCL10 expression resulted in phagocytosis blockade.
In NK cells, the CARMA1/BCL10/MALT1 complex functions in cytokine generation downstream of the receptors NKG2D, NK1.1, and Ly49D (37). Loss of BCL10 expression resulted in diminished generation of GM-CSF, chemokines, and IFN-γ in NK cells. NK cell development and maturation as well as NK cell-mediated cytotoxicity were unaffected by loss of BCL10 expression.
BCL10 has putative functions in neuronal development. In addition to immunological phenotypes, Bcl10-/- mice exhibited perinatal lethality (30% die between embryonic day 18.5 and birth), exencephaly, open neural tubes, and increased hindbrain apoptosis (28;35).
Mutations in BCL10 are associated with immunodeficiency-37 [OMIM: #616098; (38)], somatic mucosa-associated lymphoid tissue (MALT) lymphoma [OMIM: #137245; (39)], somatic non-Hodgkin lymphoma [OMIM: #605027; (40)], somatic testicular germ cell tumors [OMIM: #273300; (39;41;42)], somatic mesothelioma [OMIM: #156240; (39)], and somatic Sézary syndrome (43). The patient with immunodeficiency-37 exhibited gastroenteritis, otitis, respiratory infections as well as susceptibility to viral and yeast infections, hypogammaglobulinema, and reduced numbers of memory B and T cells and increased numbers of circulating naïve lymphocytes. MALT lymphomas are a subtype of non-Hodgkin lymphoma that often arise in the gastric mucosa (44). BCL10-associated MALT lymphomas are the result of a translocation [t(14;18)(q32;q21)] that brings BCL10 under the control of the IgH enhancer on chromosome 14. Sézary syndrome is a form of cutaneous T-cell lymphoma. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | BCL10 is required for the development of follicular, B1, and marginal zone B cells (35). The numbers of B1 B cells and marginal zone B cells were reduced in Bcl10-/- mice. Bcl10-/- mice have normal numbers of CD4+ or CD8+ thymocytes and peripheral T cells (28;35). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer Derek_pcr_F: CGATTTTCCTCCGTGTTACAGAG Derek_pcr_R: TTTAAGAGCGCTGTTGGCTC Sequencing Primer Derek_seq_F: GGCTTTAGAGAATTTACGTGTTTACC Derek_seq_R: GCGCTGTTGGCTCTCTGC |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
PCR Primers derek_PCR_F: 5’- CGATTTTCCTCCGTGTTACAGAG -3’ derek_PCR_R: 5’- TTTAAGAGCGCTGTTGGCTC -3’
Sequencing Primers derek_SEQ_F: 5’- GGCTTTAGAGAATTTACGTGTTTACC -3’ derek_SEQ_R: 5’- GCGCTGTTGGCTCTCTGC -3’
PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 55°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 40X 6) 72°C 10:00 7) 4°C hold
The following sequence of 433 nucleotides is amplified:
cgattttcct ccgtgttaca gagtaacatt gaagctttct tcttttttct cttaggcttt agagaattta cgtgtttacc tgtgtgagaa aatcatagct gagagacatt ttgatcatct acgtgcaaaa aaaatactaa gtagagaaga cacagaagaa atttcttgcc gaacttcaag tagaaaacgg gctgggaagt tgttagacta cttacaggag aaccccaggg gcctggacac cctggtggaa tccatccgca gggagaaaac acagagcttc ctgattcaga agataacgga tgaggtgcta aagcttcgga atataaaact ggagcacctc aaaggtgagc agcgggagag agcagacagc gaggagagtg gtgggtgggg gagcagacag tgaggagagc agagagccaa cagcgctctt aaa
Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G). | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Xue Zhong, Jin Huk Choi, Takuma Misawa and Bruce Beutler |