Phenotypic Mutation 'Derek' (pdf version)
AlleleDerek
Mutation Type missense
Chromosome3
Coordinate145,930,587 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Bcl10
Gene Name B cell leukemia/lymphoma 10
Synonym(s) mE10, cE10, BCL-10
Chromosomal Location 145,922,804-145,934,356 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: About one-third of homozygous null embryos die exhibiting exencephaly. Surviving mutants display immunological defects including severe immunodeficiency, abnormal B cell development and function, and impaired humoral response to bacterial infection. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009740; MGI:1337994

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000029842]
SMART Domains Protein: ENSMUSP00000029842
Gene: ENSMUSG00000028191
AA Change: D80G

DomainStartEndE-ValueType
Pfam:CARD 18 102 8e-20 PFAM
low complexity region 192 209 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000029842)
Meta Mutation Damage Score 0.9072 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 7
FACS B cells - decreased
FACS B:T cells - decreased
FACS B1 cells - decreased 12910267
FACS B1a cells in B1 cells - decreased
FACS B1b cells - decreased
FACS B1b cells in B1 cells - decreased
FACS B2 cells - increased
FACS CD4+ T cells - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T cells - increased
FACS CD8+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - decreased
FACS IgM MFI - increased
FACS IgM+ B cells - decreased
FACS macrophages - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - decreased
FACS NK cells - decreased
FACS T cells - increased
IgG1 response to a Cysteine Protease (Papain) - decreased
NK cell response - decreased
NK killing - decreased
OVA-specific IgE - increased 1163238
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Total IgE After 2nd OVA/Alum Challenge (day 7) - increased
total IgE level - increased 1163238
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.901; ML prob: 0.8544; human score: -0.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(8) : Gene trapped(5) Radiation induced(1) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Bcl10 APN 3 145933184 nonsense probably null
R1161:Bcl10 UTSW 3 145930425 missense probably damaging 0.99
R1310:Bcl10 UTSW 3 145930425 missense probably damaging 0.99
R2570:Bcl10 UTSW 3 145933030 missense probably benign 0.13
R4669:Bcl10 UTSW 3 145930572 missense probably damaging 1.00
R5301:Bcl10 UTSW 3 145930587 missense probably damaging 1.00
R5691:Bcl10 UTSW 3 145933149 missense probably benign 0.03
R7008:Bcl10 UTSW 3 145933299 missense probably benign 0.05
R7384:Bcl10 UTSW 3 145933040 missense possibly damaging 0.90
R7853:Bcl10 UTSW 3 145924511 missense possibly damaging 0.90
Z1176:Bcl10 UTSW 3 145930513 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2021-03-22 4:00 PM by External Program
Record Created 2017-07-06 8:53 AM by Bruce Beutler
Record Posted 2018-04-25
Phenotypic Description

Figure 1. Derek mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Derek mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Derek mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Derek mice exhibit increased frequencies of peripheral CD44+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Derek mice exhibit increased frequencies of peripheral CD44+ CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Derek mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Derek mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Derek mice exhibit increased expression of CD44 on peripheral CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Derek mice exhibit increased expression of IgM on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Derek mice exhibited increased levels of IgE in the serum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Derek mice exhibited increased levels of IgE in the serum after administration of OVA-alum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Derek mice exhibited increased levels of OVA-specific IgE in the serum after administration of OVA-alum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Homozygous derek mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Homozygous derek mice exhibit diminished T-independent IgM responses to NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The derek phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5301, some of which showed reduced frequencies B1 cells (Figure 1) with concomitant increased frequencies of T cells (Figure 2), CD4+ T cells (Figure 3), CD44+ T cells (Figure 4), CD44+ CD4 T cells (Figure 5), all in the peripheral blood. CD44 expression was increased on the surface of peripheral blood T cells (Figure 6), CD4+ T cells (Figure 7), and CD8+ T cells (Figure 8). IgM expression was increased on the surface of peripheral blood B cells (Figure 9). Some mice exhibited increased levels of IgE in the serum (Figure 10). Serum levels of total IgE (Figure 11) and OVA-specific IgE (Figure 12) were elevated after administration of ovalbumin compared to that in wild-type mice. The T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 13) and the T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) were also diminished compared to that in wild-type littermates (Figure 14). 

Nature of Mutation

Figure 15. Linkage mapping of the increased serum IgE phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R5301. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Bcl10:  an A to G transition at base pair 145,930,587 (v38) on chromosome 3, or base pair 6,326 in the GenBank genomic region NC_000069 encoding Bcl10. The strongest association was found with a recessive model of inheritance to the normalized total IgE levels (without ovalbumin administration), wherein three variant homozygotes departed phenotypically from 19 homozygous reference mice and 28 heterozygous mice with a P value of 5.541 x 10-47 (Figure 15). The reduced B1 cell frequency and CD4+ T cell phenotypes were found with an additive model of inheritance, but the mutation is preponderantly recessive.

 

The mutation corresponds to residue 436 in the mRNA sequence NM_009740 within exon 2 of 3 total exons.

 

420 AACCCCAGGGGCCTGGACACCCTGGTGGAATCC

75  -N--P--R--G--L--D--T--L--V--E--S-

 

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid to glycine substitution at position 80 (D80G) in the Bcl10 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 16. Domain structure of BCL10. The derek mutation results in an aspartic acid to glycine substitution at position 80. Abbreviations: CARD, caspase recruitment domain.

BCL10 (B cell lymphoma 10) has a caspase recruitment domain (CARD) domain at its N-terminus and a Ser/Thr-rich region at the C-terminus. The BCL10 CARD domain mediates the interaction with the CARD domain of CARMA1 (see the record for king) and with the immunoglobulin-like domains of MALT1 (mucosa-Associated Lymphoid tissue lymphoma Translocation-associated gene 1; also known as MLT or Paracaspase; see the record for mousebird) (1). The BCL10 CARD domain is unstructured and dynamic when not bound to CARMA1; however, when bound to CARMA1, it aggregates and forms stable filaments (2;3). The Ser/Thr-rich region of BCL10 interacts with the Ig-like domains of MALT1 (4). The function of the CARMA1/BCL10/MALT1 complex is detailed in the “Background” section, below.

 

BCL10 undergoes several posttranslational modifications upon antigen receptor stimulation as well as after PMA, PMA and ionomycin, or UV treatment [reviewed in (5)]. BCL10 is a substrate of MALT1, which cleaves its substrates after arginine residues. BCL10 is ubiquitinated by TRAF6, which putatively recruits the IKK complex via IKKγ, subsequently promoting further IKK activation by TRAF6-dependent ubiquitination (6;7). BCL10 can be phosphorylated by several kinases, which can either positively or negatively regulate the BCL10 function. IKK-mediated phosphorylation of BCL10 (specific residues have not been identified) promotes CARMA1/BCL10/MALT1 complex stability. IKK-mediated phosphorylation of Thr81 and Ser85 promotes BCL10 ubiquitination by the β-TrCP E3 ligase and subsequent targeting of BCL10 for lysosomal or proteasomal degradation (8;9). IKK-mediated phosphorylation of serines 134, 136, 138, 141, and 144 after TCR stimulation causes dissociation from MALT1 (10). Ca2+–calmodulin-dependent protein kinase II (CaMKII)-mediated phosphorylation of Ser138 after stimulation with PMA and ionomycin attenuates NF-κB-associated signaling as well as regulates the interactions with CARMA1 and MALT1 and the signal-induced ubiquitination of BCL10 (11-14). Phosphorylation of Ser138 by an unidentified kinase promotes BCL10-associated actin polymerization in T cells, monocytes, and macrophages (15). RIP2-mediated phosphorylation of BCL10 (specific residues have not been identified) after TCR stimulation induces positive regulation of NF-κB activation (16). AKT-mediated phosphorylation of serines 218 and 231 promote binding to the IκB family member BCL3 (see the record for sunrise) and the subsequent nuclear accumulation of BCL10 after TNFα (see the record for Panr1) stimulation (17;18).

 

The derek mutation results in an aspartic acid to glycine substitution at position 80 (D80G) in the BCL10 protein; amino acid 80 is within the CARD domain.

Expression/Localization

BCL10 is ubiquitously expressed [reviewed in (5)]. CARMA1 binding to BCL10 promotes the translocation of BCL10 from the cytoplasm to the nucleus (19). At the perinuclear region, BCL10 accumulation mediates nuclear NF-κB activation (20).

Background
Figure 17. Canonical and non-canonical NF-kB signaling pathways. In the canonical pathway, several membrane receptors, including TNFR (tumor-necrosis factor receptor), IL-1R (interleukin-1 receptor) and TLRs (toll-like receptors), signal through kinases and adaptors (TRAFs), resulting in IKK activation. This activation occurs after the K63 ubiquitination of TRAFs and RIP. TAK1 and its adaptor proteins TAB1 and TAB2 bind ubiquitin chains to TRAF and NEMO (IKKγ) resulting in the activation of the IKK complex (NEMO, IKKα and IKKβ). Ubiquitination can be inhibited by deubiquitinating enzymes (DUB). Stimulation of the T-cell receptor (TCR) and B-cell receptor (BCR) results in the recruitment of Src and Syk family kinases. These kinases activate a phosphorylation cascade which leads to the activation of protein kinase C (PKC). The phosphorylation of CARMA1 (CARD (caspase-recruitment domain)-MAGUK (membrane-associated guanylate kinase) protein 1) recruits BCL 10 (B-cell lymphoma 10) and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1), forming the CBM complex and activating the IKK complex. The IKK complex phosphorylates both IκB, p105 and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles) by 26S proteasome. Degradation of IκB releases activated NF-κB dimers for translocation to the nucleus. A subset of TNFRs such as the lymphotoxin-β receptor (LT-bR),CD40, B-cell-activating factor receptor (BAFFR) and receptor activator of Nf-κB (RANK) can activate the canonical or non-canonical NF-κB signaling pathways. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. (Gray arrows represent ubiquitination dependence.) As TRAF levels decrease, NIK is released and phosphorylates IKKa which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. This image is interactive. Click on the image to view mutations in the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

NF-κB controls the proliferation, differentiation and survival of B and T cells by activating the transcription of target genes, including various cytokines. In unstimulated cells, NF-κB is sequestered in the cytoplasm by the inhibitory protein IκB, which binds to NF-κB and prevents its translocation to the nucleus. Stimulation of B cell receptors (BCR) or T cell receptors (TCR) together with costimulatory molecules leads to the activation of IκB kinase (IKK) to phosphorylate IκB, triggering the ubiquitination and degradation of IκB, ultimately resulting in activation of NF-κB by releasing it for translocation to the nucleus. BCR or TCR engagement results in the formation of a lipid raft-associated multiprotein complex (called the “immunological synapse” in T cells) at the site of cell-cell contact that controls the events leading to activation of NF-κB (21). Scaffold proteins are essential for the formation of these complexes, promoting the coordinated receptor- and cell-specific assembly of signaling molecules.

 

Upon T cell activation by TCR and costimulatory molecule engagement, CARMA1 associates with a complex containing Bcl10 and MALT1 and recruits these proteins to lipid rafts of the immunological synapse, where they activate the IKK complex, leading to degradation of IκB and subsequent activation of NF-κB (22-25) (8;11-13). The CARMA1/Bcl10/MALT1 complex functions similarly in B cells to activate NF-κB in response to BCR engagement (26).

 

The phenotypes of CARMA1, Bcl10, MALT1, PKCβ, and PKCθ mutant mice, or cells derived from these mice, provide support for the intermolecular interactions between these proteins revealed by studies in B and T cell lines. For example, PKCβ-/- mice display selective loss of peritoneal B1 cells and reduced immunoglobulin levels (27). Both Bcl10-/- and MALT1-/- mice have increased DN4 relative to DN3 cells, and reduced basal levels of immunoglobulins (28;29). B cells from Bcl10-/- mice and T cells from PKCθ-/- mice fail to proliferate in response to BCR or TCR activation, respectively (28;30). Importantly, primary B or T cells from CARMA1, Bcl10, MALT1, PKCβ, and PKCθ mutants all exhibit impaired NF-κB and JNK activation induced by either PMA/ionomycin or antigen receptor ligation (23;28;29;31-34). These findings support the conclusion that CARMA1, Bcl10, MALT1 and PKC function in the same pathway (in a complex at the immunological synapse), to activate NF-κB in response to antigen receptor stimulation. Bcl10-/- mice also show reduced IgG and IgM levels after injection of vesicular stomatitis virus (28). The Bcl10-/- mice showed defective antibody responses to both T cell-independent and T cell-dependent antigens (35).  

 

BCL10 functions in NF-κB-independent actin and membrane remodeling as well as endosomal trafficking downstream of the FcR in macrophages (36). BCL10 interacts with the clathrin adaptors AP1 and EpsinR, which are required for completion of phagosome closure. The binding of BCL10 and AP1 facilitates the delivery of the PI(4,5)Pphosphatase OCRL1 to nascent phagocytic cups, subsequently regulating F-actin dynamics. Loss of BCL10 expression resulted in phagocytosis blockade.

 

In NK cells, the CARMA1/BCL10/MALT1 complex functions in cytokine generation downstream of the receptors NKG2D, NK1.1, and Ly49D (37). Loss of BCL10 expression resulted in diminished generation of GM-CSF, chemokines, and IFN-γ in NK cells. NK cell development and maturation as well as NK cell-mediated cytotoxicity were unaffected by loss of BCL10 expression.

 

BCL10 has putative functions in neuronal development. In addition to immunological phenotypes, Bcl10-/- mice exhibited perinatal lethality (30% die between embryonic day 18.5 and birth), exencephaly, open neural tubes, and increased hindbrain apoptosis (28;35).

 

Mutations in BCL10 are associated with immunodeficiency-37 [OMIM: #616098; (38)], somatic mucosa-associated lymphoid tissue (MALT) lymphoma [OMIM: #137245; (39)], somatic non-Hodgkin lymphoma [OMIM: #605027; (40)], somatic testicular germ cell tumors [OMIM: #273300; (39;41;42)], somatic mesothelioma [OMIM: #156240; (39)], and somatic Sézary syndrome (43). The patient with immunodeficiency-37 exhibited gastroenteritis, otitis, respiratory infections as well as susceptibility to viral and yeast infections, hypogammaglobulinema, and reduced numbers of memory B and T cells and increased numbers of circulating naïve lymphocytes. MALT lymphomas are a subtype of non-Hodgkin lymphoma that often arise in the gastric mucosa (44). BCL10-associated MALT lymphomas are the result of a translocation [t(14;18)(q32;q21)] that brings BCL10 under the control of the IgH enhancer on chromosome 14. Sézary syndrome is a form of cutaneous T-cell lymphoma.

Putative Mechanism

BCL10 is required for the development of follicular, B1, and marginal zone B cells (35). The numbers of B1 B cells and marginal zone B cells were reduced in Bcl10-/- mice. Bcl10-/- mice have normal numbers of CD4+ or CD8+ thymocytes and peripheral T cells (28;35).

Primers PCR Primer
Derek_pcr_F: CGATTTTCCTCCGTGTTACAGAG
Derek_pcr_R: TTTAAGAGCGCTGTTGGCTC

Sequencing Primer
Derek_seq_F: GGCTTTAGAGAATTTACGTGTTTACC
Derek_seq_R: GCGCTGTTGGCTCTCTGC
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

PCR Primers

derek_PCR_F: 5’- CGATTTTCCTCCGTGTTACAGAG -3’

derek_PCR_R: 5’- TTTAAGAGCGCTGTTGGCTC -3’

 

Sequencing Primers

derek_SEQ_F: 5’- GGCTTTAGAGAATTTACGTGTTTACC -3’
 

derek_SEQ_R: 5’- GCGCTGTTGGCTCTCTGC -3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 433 nucleotides is amplified:

 

cgattttcct ccgtgttaca gagtaacatt gaagctttct tcttttttct cttaggcttt

agagaattta cgtgtttacc tgtgtgagaa aatcatagct gagagacatt ttgatcatct

acgtgcaaaa aaaatactaa gtagagaaga cacagaagaa atttcttgcc gaacttcaag

tagaaaacgg gctgggaagt tgttagacta cttacaggag aaccccaggg gcctggacac

cctggtggaa tccatccgca gggagaaaac acagagcttc ctgattcaga agataacgga

tgaggtgcta aagcttcgga atataaaact ggagcacctc aaaggtgagc agcgggagag

agcagacagc gaggagagtg gtgggtgggg gagcagacag tgaggagagc agagagccaa

cagcgctctt aaa

  

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

References
 29.  Ruefli-Brasse, A. A., French, D. M., and Dixit, V. M. (2003) Regulation of NF-kappaB-dependent lymphocyte activation and development by paracaspase, Science 302, 1581-1584.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Takuma Misawa and Bruce Beutler