Phenotypic Mutation 'plateau' (pdf version)
List |< first << previous [record 13 of 74] next >> last >|
Alleleplateau
Mutation Type critical splice donor site
Chromosome11
Coordinate97,101,478 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Tbx21
Gene Name T-box 21
Synonym(s) Tbet, Tblym, T-bet, TBT1
Chromosomal Location 97,098,071-97,115,331 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human ortholog of mouse Tbx21/Tbet gene. Studies in mouse show that Tbx21 protein is a Th1 cell-specific transcription factor that controls the expression of the hallmark Th1 cytokine, interferon-gamma (IFNG). Expression of the human ortholog also correlates with IFNG expression in Th1 and natural killer cells, suggesting a role for this gene in initiating Th1 lineage development from naive Th precursor cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in the production of NK and NK-T cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_019507; MGI:1888984

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000001484]
SMART Domains Protein: ENSMUSP00000001484
Gene: ENSMUSG00000001444

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
TBOX 135 330 4.82e-111 SMART
low complexity region 498 515 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (BP Female) - decreased
Body Weight (Female) - decreased
FACS CD4:CD8 - decreased
FACS CD8+ T cells in CD3+ T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgM MFI - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(1) Gene trapped(1) Targeted(5) Transgenic(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tbx21 APN 11 97098923 missense probably damaging 0.97
IGL00957:Tbx21 APN 11 97099094 missense probably benign 0.00
IGL00975:Tbx21 APN 11 97100082 missense possibly damaging 0.54
IGL02015:Tbx21 APN 11 97098914 missense probably benign
IGL02930:Tbx21 APN 11 97100039 missense probably damaging 1.00
IGL03378:Tbx21 APN 11 97114741 missense probably benign 0.01
R1923:Tbx21 UTSW 11 97100037 missense probably damaging 1.00
R4569:Tbx21 UTSW 11 97114755 missense probably benign 0.11
R4662:Tbx21 UTSW 11 97101567 missense probably benign 0.01
R4847:Tbx21 UTSW 11 97115031 missense probably damaging 0.99
R5049:Tbx21 UTSW 11 97114710 missense probably benign 0.08
R5364:Tbx21 UTSW 11 97101478 critical splice donor site probably null
R5873:Tbx21 UTSW 11 97114648 critical splice donor site probably null
R6064:Tbx21 UTSW 11 97114911 missense probably damaging 0.96
R6516:Tbx21 UTSW 11 97099956 missense possibly damaging 0.54
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2018-09-13 3:19 PM by Anne Murray
Record Created 2017-07-24 3:06 PM by Bruce Beutler
Record Posted 2018-09-13
Phenotypic Description
Figure 1. Plateau mice exhibit reduced CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Plateau mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Plateau mice exhibit increased frequencies of peripheral effector memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Plateau mice exhibit increased IgM expression on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The plateau phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5364, some of which showed a decrease in the CD4 to CD8 T cell ratio (Figure 1) due to increased frequencies of CD8+ T cells in CD3+ T cells (Figure 2) and effector memory CD8 T cells in CD8 T cells (Figure 3) in the peripheral blood. Expression of IgM on peripheral blood B cells was increased (Figure 4).

Nature of Mutation

Figure 2. Linkage mapping of reduced TNFα secretion after LPS stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0304. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 98 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tbx21:  a G to A transition at base pair 97,101,478 (v38) on chromosome 11, or base pair 13,854 in the GenBank genomic region NC_000077 within the donor splice site of intron 3. The strongest association was found with a dominant model of inheritance to the normalized frequency of CD8+ T cells in CD3+ T cells, wherein nine variant homozygotes and 18 heterozygous mice departed phenotypically from 19 homozygous reference mice with a P value of 3.699 x 10-6 (Figure 5).  

 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in skipping of the 122-nucleotide exon 3 (out of 6 total exons), resulting in a frame-shifted protein product beginning after amino acid 214 of the protein and premature termination after the inclusion of 20 aberrant amino acids.

 

          <--exon 2      <--exon 3 intron 3-->             <--exon 4-->

825 ……GGCAGCATGCCAG ……AATGTGACCCAG gtaggattgtcagac…… ATGATCGTCCT……GGAGGTGAATGA…… 1021

211 ……-G--S--M--P-- ……-N--V--T--Q-                   D--D--R--P-……-G--G--E--*-

        correct         deleted                              aberrant

 

The donor splice site of intron 3, which is destroyed by the Plateau mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 3. Domain organization of the T-bet protein. The plateau mutation destroys the donor splice site of intron 3.

Tbx21 encodes T-box expressed in T cells (T-bet; alternatively, T-box21 [TBX21]). T-bet is a member of the T-box transcription factor family. The T-box proteins have a highly conserved central DNA-binding T-box domain of approximately 180 amino acids (Figure 3) (1). The T-box proteins differ in sequence and length at the N- and C-termini (2).

 

T-bet can interact with and recruit a H3K4me2 methyltransferase complex to the promoters of target genes (2). Non-DNA contact regions within the T-box, termed T-box domain 1 and 2, are required for interaction with the H3K4me2 methyltransferase complex. T-box domain 1 and 2 are both required for H3K4me2 modification, but only T-box domain 1 is necessary for interaction with the H3K4me2 methyltransferase complex. T-box domain 2 putatively mediates the removal of the repressive H3K27me3 modification before the addition of H3K4me2 modification.

 

T-bet is phosphorylated on several residues. mTORC1 mediates phosphorylation at Ser52, Tyr76, Ser224, and Ser508, which regulates T helper type 1 (TH1) differentiation (3). c-Abl phosphorylates T-bet at Tyr219, Tyr265, and Tyr304, promoting the induction of TH1 cell development and the suppression of TH2 cell development  (4). Phosphorylation of Thr302 promotes T-bet interaction with NFAT as well as suppression of IL-2 and TH2 cytokines (5). GSK3-mediated phosphorylation of Ser508 promotes T-bet interaction with NF-κB p65 as well as inhibition of IL-2 (6). ITK-induced phosphorylation of Tyr525 promotes the interaction between T-bet and GATA3 and suppression of TH2 cytokines (7). T-bet is also ubiquitinated. Ubiquitination of Lys313 promotes binding to DNA and controls protein stability (5).

 

The Plateau mutation is predicted to result in a frame-shifted protein product beginning after amino acid 214 of the protein and premature termination after the inclusion of 20 aberrant amino acids. The affected region is with the T-box domain.

Expression/Localization

TBX21 is expressed in peripheral blood leukocytes as well as the lung, thymus, and spleen (1;8). T-cell receptor (TCR) and STAT1-associated signaling induces T-bet expression in TH cell precursors (9;10). T-bet expression is then driven by IL12-STAT4 signaling in a TCR-independent manner (9-11). T-bet expression is also induced by inflammatory cytokines.

Background

The T-box proteins function in the regulation of developmental processes. T-bet has several functions, including the effector differentiation and function of CD4, CD8, CD8αα+ intraepithelial T cells, natural killer (NK) cells, NK T cells, dendritic cells, innate lymphoid cells, and B cells (12). T-bet regulates the expression and function of several genes (Table 1).

 

Table 1. T-bet regulates the expression and function of several proteins

Interacting protein

T-bet associated function

References

CXCR3

TH1 cell differentiation and migration

(20)

CCL3 and CCL4

TH1 cell migration

(20;21)

IFNγ

TH1 cell differentiation

(1)

IL-12Rβ2

Stimulation of IFNγ production in TH1 cell differentiation

(22)

Hobit

Transcription factor that (along with Blimp-1) shuts down lymphocyte egress from nonlymphoid tissue

(12)

IL-2Rβ (alternatively, CD122 or IL-15Rβ)

Proliferation and survival of NK cells and ILC1; development of NKT1 and CD8αα+ intraepithelial T cells

(23)

Hlx-1

TH1 cell differentiation

(22)

RUNX3

Ifng and Il4 activation or repression in TH1 cells, respectively

(24)

GATA3

T-bet suppresses GATA3 by sequestering GATA3 from the IL-5 and IL-3 promoters, subsequently antagonizing the development of TH2 lineages by suppressing the production of TH2 cytokines (e.g., IL-4, IL-5, and IL-13)

(7)

RUNX1

Blocks RORγt (see the record for chestnut) expression, subsequently antagonizing the development of TH17 lineages

(25)

BCL6

T-bet uses Bcl-6 to repress gene expression in TH1 cells, promoting TFH development

(26)

PD-1

T-bet represses Pdcd1 transcription in CD8+ T cells, sustaining virus-specific CD8+ T cell responses during chronic infection

(27)

NF-κB p65

T-bet inhibits NF-κB p65 activity, subsequently suppressing IL-2 production during TH1 and TH2 differentiation

(6)

Granzymes A, K, and M; perforin (see the record for prime)

Cytotoxic molecules regulated by T-bet in effector CD8+ T cell differentiation

(28)

 

T-bet also interacts with and recruits several chromatin remodeling complexes to its target genes (2;22;23). T-bet-associated chromatin accessibility allows for other transcriptional activators (e.g., NFAT, AP-1, STAT4, and NF-κB) to bind to T-bet target genes and promote gene transcription (24-26). T-bet can also promote the dissociation of corepressors (e.g., mSin3a) from promoters (27) as well as the removal of Sin3A-histone deacetylase complexes (28).

 

Figure 4. T-bet influence on immune cells. T-bet is expressed in multiple cells of the innate and adaptive immune system. Its expression is required for the survival, development and proper functions of immune cells. T-bet is required for the differentiation of TH1 cells. In addition to promoting the TH1 differentiation program, T-bet suppresses commitment to the TH2 or TH17 lineage. Select T-bet target genes are shown in each cell type. See the text for more information about T-bet function in the immune system. More information about some of these target genes are shown in Table 1.

T-bet functions in the initiation of TH1 lineage development from naïve TH precursor cells (Figure 4). T-bet controls the expression of TH1 cytokine interferon (IFN)-γ in CD4+ cells (1;29). T-bet concomitantly regulates IL-2 and TH2 cytokines (i.e., IL-4, IL-5, and IL-13) in an IFN-γ-independent manner, resulting in an attenuation of TH2 cell development (7). T-bet also inhibits TH17 differentiation (18).

 

T-bet is required for IFN-γ expression in CD8+ T cells as well as CD8+ T cell cytolytic activity (30). T-bet is required for the development of short-lived CD8 effector cells but has little effect on memory precursor cells (31). In addition, T-bet functions in the development of tissue-resident memory T cells, which are memory CD8 T cells that reside in nonlymphoid tissues (32).

 

In dendritic cells, T-bet is required for IFN-γ production in response to IL-12 and IL-18 stimulation (33). T-bet in dendritic cells is required for the priming of antigen-specific CD4+ T cells (34).

 

T-bet induces the expression of IL-15Rα during the maturation and differentiation of NK cells, other group 1 innate lymphoid cells (ILC1), and invariant T cells (e.g., NKT1 and CD8αα+ intraepithelial T cells). IL-15Rα is required for the proliferation and survival of NK cells and some ILC1 populations (35-37).

 

T-bet is a regulator of the isotype switch to IgG2a in B cells (38), subsequently regulatory the formation of IgG2a+ memory B cells and IgG2a-producing plasma cells (39). Other factors are predicted to be able to compensate for T-bet in germinal center B cells or during the differentiation of IgG2a+ antibody-secreting cells (38;40). T-bet inhibits the switching to IgG1 and IgE during Th2 cell responses (41). T-bet regulates the expression of costimulatory molecules, activation-induced cytidine deaminase (AID), and CXCR3 during chronic LCMV infection (42).

 

T-bet regulates mucosal homeostasis and the homeostatic response to intestinal microbiota (43;44). Innate immune system-specific T-bet knockout mice develop spontaneous colitis (44); however, mice bred in pathogen-free conditions do not develop colitis (45). The mice showed increased activation of CD11c+ MHCII+CD103- dendritic cells, which produce increased levels of TNF. Elevated TNF signaling caused epithelial cell apoptosis and aberrant epithelial membrane integrity. The CD11c+ MHCII+CD103- dendritic cells also produced IL-23, which (along with the TNF) activated type 3 RORγt+ innate lymphoid cells (ILCs). Type 3 ILCs produce inflammatory cytokines (e.g., IL-17 and IL-22) that cooperate with TNF to recruit neutrophils to the colonic lamina propria [reviewed in (46)].

 

Mutations in TBX21 are linked to asthma and nasal polyps as well as susceptibility to aspirin-induced asthma (OMIM: #208550) (47). T-bet dysregulation is associated with the development of several inflammatory and autoimmune diseases, including colitis (44;48), systemic lupus erythematosus (49), and type I diabetes (50).

 

Homozygous mice expressing an ENU-induced mutant Tbx21 allele (Tbx21duane/duane) exhibited defects in NK cell differentiation as well as reduced NK cell number in the blood, spleen, and liver, but increased NK cell number in the peripheral lymph nodes and bone marrow. The Tbx21duane/duane mice exhibited loss of NK T cells. Tbx21-deficient (Tbx21-/-) mice exhibited defects in Th17 CD4+ T cell differentiation upon exposure to IL-12 (51). Tbx21-/- mice showed reduced numbers of CD4+ T cells and CD4+ memory T cells as well as reduced NK T cell number (52;53). Tbx21-/- mice showed reduced Th1 cell number with concomitant increased Th2 cell number (29). Tbx21-/- mice also exhibited increased susceptibility to dextran sodium sulfate (DSS)-induced colitis (54). Tbx21-/- mice showed increased weight gain and adiposity after high-fat diet; however the mice showed improved insulin sensitivity (55).

Putative Mechanism

The phenotypes observed in the plateau mice indicate loss of T-bet-associated function, namely in T cell differentiation and function.

Primers PCR Primer
plateau(F):5'- GCTAGCACCTTTGTCTAGTCTG -3'
plateau(R):5'- AATCCCACATCTCCAGTGTCTG -3'

Sequencing Primer
plateau_seq(F):5'- ACATCAATCAGGCCTGGTG -3'
plateau_seq(R):5'- GTCTGGTCGATACTTGACAATAAGG -3'
References
Science Writers Anne Murray
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 13 of 74] next >> last >|