Phenotypic Mutation 'vanishing'

• Allele: vanishing
• Mutation Type: nonsense
• Chromosome: 14
• Coordinate: 119,209,799 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Dnajc3
• Gene Name: DnaJ heat shock protein family (Hsp40) member C3
• Synonym(s): Dnajc3, Dnajc3a, mp58, Dnajc3b, Prkri, p58IPK
• Chromosomal Location: 119,175,388-119,219,109 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple tetratricopeptide repeat (TPR) motifs as well as the highly conserved J domain found in DNAJ chaperone family members. It is a member of the tetratricopeptide repeat family of proteins and acts as an inhibitor of the interferon-induced, dsRNA-activated protein kinase (PKR). [provided by RefSeq, Jul 2010] ; PHENOTYPE: Homozygous null mice are smaller in size, have a lower percentage of body fat and develop a gradual onset of glucosuria and hyperglycemia associated with increasing apoptosis of pancreatic islet cells. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000022734]
• AlphaFold: Q91YW3
• PDB Structure: Crystal Structure of P58(IPK) TPR Domain at 2.5 A [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000022734; Gene: ENSMUSG00000022136; AA Change: Y291*

Domain	Start	End	E-Value	Type
TPR	37	70	2.02e1	SMART
TPR	71	104	2.52e-1	SMART
TPR	105	138	4.99e-5	SMART
TPR	188	221	1.16e0	SMART
TPR	222	255	4.96e0	SMART
TPR	306	339	4.1e1	SMART
TPR	340	373	6.58e-5	SMART
DnaJ	393	454	6.88e-26	SMART

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Possibly essential (E-score: 0.511)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-08-16 3:28 PM by Bruce Beutler
• Record Posted: 2018-09-14
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer, Zhao Zhang, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008929; MGI:107373

Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (other)(1) Gene trapped(11) Radiation induced(1) Targeted(3)

Phenotypic Description

Figure 1. Vanishing mice exhibited reduced body weights compared to wild-type littermates . Scaled weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Vanishing mice exhibited increased susceptibility to dextran sodium sulfate (DSS)-induced colitis. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Vanishing mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Vanishing mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Vanishing mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The vanishing phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5398, some of which showed reduced body weights compared to wild-type littermates (Figure 1). Some mice also showed susceptibility to dextran sodium sulfate (DSS)-induced colitis (Figure 2) as well as increased frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), and CD44+ CD8 T cells (Figure 5) in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of the increased CD44+ CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 55 mutations (X-axis) identified in the G1 male of pedigree R5398. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. All of the above anomalies were linked to a mutation in Dnajc3: a T to A transversion at base pair 118,972,387 (v38) on chromosome 14, or base pair 34,456 in the GenBank genomic region NC_000080 encoding Dnajc3. The strongest association as found with a recessive model of inheritance to the CD44+ CD8 T cell frequency, wherein three variant homozygotes departed phenotypically from seven homozygous reference mice and 23 heterozygous mice with a P value of 1.061 x 10^-6 (Figure 6). 

The mutation corresponds to residue 1,030 in the mRNA sequence NM_008929 within exon 8 of 12 total exons.

1013 GATGCAACCAGCAAATATGAATCAGTCATGAAA 286  -D--A--T--S--K--Y--E--S--V--M--K-

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 291 for a premature stop codon (Y291*) in the DNAJC3 protein.

Protein Prediction

Figure 7. Domain structure of P58 IPK . The vanishing mutation results in the substitution of tyrosine 291 for a premature stop codon. Abbreviations: TPR, tetratricopeptide repeat.

Figure 8. Crystal structure of human P58^IPK. The relative location of the vanishing mutation is noted. Figure generated by UCSF Chimera and is based on PDB:2Y4U.

Dnajc3 encodes P58^IPK (alternatively, DnaJC3 or PRKRI), a member of the DnaJ subfamily of the HSP40 (alternatively, J) family of chaperones. P58^IPK has nine tetratricopeptide repeat (TPR) motifs near the N-terminus, a flexible linker region, and a highly conserved J (alternatively, DnaJ) domain at the C-terminus (Figure 7) (1-3). The J domain and a conserved Hsp70-binding histidine-proline-aspartate (HPD) motif mediate its interaction with Hsp70/BiP. An N-terminal ER-targeting signal domain mediates translocation of P58^IPK from the cytosol to the ER (4).

TPRs are 34-amino acid motifs that mediate protein-protein interactions and the assembly of multiprotein complexes (3;5-7). TPR motifs 1 to 4 of P58^IPK promote self-interaction (8). The sixth TPR motif of P58^IPK interacts with the interferon-induced double-stranded RNA-activated protein kinase (PKR; alternatively, eukaryotic translation initiation factor 2-alpha kinase 2 [Eif2ak2]) (8). The seventh TPR motif of P58^IPK interacts with P52^rIPK (52-kDa repressor of the inhibitor of protein kinase) (9).

The structure of human P58^IPK (minus the last 43 amino acids) has been solved [Figure 8; PDB:2Y4U; (10)]. P58^IPK is an elongated protein comprised entirely of α-helices. The HPD motif is at the very edge of the elongated protein. The nine TPR motifs are comprised of 19 α-helices in a helix-turn-helix arrangement. They are separated into three subdomains: TPR1 through TPR3 (helices 1 through 7), TPR4 through TPR6 (helices 7 through 13), and TPR7 through TPR9 (helices 13 through 19) (10). A hydrophobic patch in subdomain I putatively binds misfolded proteins (e.g., luciferase, rhodanese, and insulin) (11). The J domain is comprised of four helices. The second helix of the J domain has basic residues that can facilitate binding to the ATPase domain of BiP (10;12)].

The vanishing mutation results in substitution of tyrosine 291 for a premature stop codon (Y291*) in the DNAJC3 protein; amino acid 291 is within the seventh TPR motif.

Expression/Localization

DNAJC3 is ubiquitously expressed (NCBI). Dnajc3 expression is induced by ER stress (13). In the retina, P58^IPK is expressed predominantly in retinal ganglion cells (RGC), inner retinal neurons, and the photoreceptor inner segments (14). P58^IPK is localized to the ER lumen (15).

Background

Figure 9. P58^IPK functions in the unfolded protein response (UPR). The UPR promotes protein folding through the synthesis of ER resident chaperones as well as enhanced ER-associated protein degradation (ERAD) and global repression of protein synthesis. Three ER resident transmembrane proteins, IRE1, protein kinase RNA (PKR)-like ER kinase/pancreatic eIF2α kinase (PERK), and activating transcription factor 6 (ATF6) mediate UPR signaling. IRE1 senses ER stress and transmits a signal to the nucleus by initiating spliceosome-independent splicing of Xbp1, a basic leucine zipper transcriptional regulator of the UPR. The mature from of XBP1 facilitates the upregulation of several gene products  including ER-resident proteins that will assist in protein folding and maturation as well as ER-associated proteins that will assist in protein degradation. Upon recognition of misfolded proteins in the ER, PERK phosphorylates the translation initiation factor eIF2α that inhibits global protein synthesis by blocking the formation of an active 43S translation-initiation complex. S1P cleaves ATF6, a transcription factor activated by ER stress. Under normal conditions, ATF6 is held in the ER by interactions with the chaperone, GRP78. Accumulation of misfolded proteins in the ER leads to ER stress and the subsequent release of ATF6 from GRP78. The dissociation of GRP78 exposes a Golgi localization sequence on ATF6 that targets ATF6 to the Golgi via COPII vesicles. Within the Golgi, ATF6 is cleaved by S1P and S2P to free the basic leucine zipper and transactivation domain (TA) of ATF6 to translocate to the nucleus where it binds to ER stress responsive elements (ERSE) to activate unfolded protein response (UPR) genes.

Accumulation of misfolded proteins in the ER lumen, glucose starvation, inhibition of protein glycosylation, and disturbance of intracellular calcium stores results in ER stress. To alleviate ER stress and to restore the ER to its normal state, a series of signaling pathways, termed the unfolded protein response (UPR) promotes protein folding through the synthesis of ER resident chaperones (e.g., BiP/GRP78 and GRP94) and folding catalysts as well as enhanced ER-associated protein degradation (ERAD) and global repression of protein synthesis (Figure 9). Three ER resident transmembrane proteins, IRE1 (see the record for ernie), protein kinase RNA (PKR)-like ER kinase/pancreatic eIF2α kinase (PERK), and activating transcription factor 6 (ATF6) mediate UPR signaling. Upon recognition of misfolded proteins in the ER, PERK phosphorylates the translation initiation factor eIF2α that inhibits global protein synthesis by blocking the formation of an active 43S translation-initiation complex (i.e., 40S subunit, eIF1, eIF1A, eIF3, eIF2-GTP-Met-tRNA^Met, and eIF5).

P58^IPK is a co-chaperone of BiP (11;15;16). P58^IPK binds unfolded or misfolded proteins and delivers them to BiP (11). P58^IPK is also a putative negative regulator of eIF2α signaling during the UPR (17). Reduced P58^IPK expression inhibited eIF2α phosphorylation and caused reduced expression of eIF2α targets. P58^IPK binds PERK, which controls PERK-dependent phosphorylation of eIF2 during the UPR (13).

P58^IPK is also an inhibitor of PKR (18-21). P58^IPK binding to PKR regulates its autophosphorylation and activity (18). PKR, upon activation by dsRNA, phosphorylates eIF2α, leading to decreased synthesis of host and viral proteins. The virus recruits P58^IPK to inactivate PKR, so that viral protein synthesis can continue and increase (20-22). P58^IPK binding to PKR is inhibited by interaction with P52^rIPK (9). Although P58^IPK prolongs viral replication, it inhibits virus-induced apoptosis and inflammation to prolong host survival (23). Dnajc3-deficient (Dnajc3^-/-) mice infected with influenza virus showed increased lung pathology, immune cell apoptosis, PKR activation, and mortality (23). The expression of cell death, immune, and inflammation genes was increased in the influenza-infected Dnajc3^-/- mice.

Through its inhibition of PKR, P58^IPK suppresses NLRP3 (see the record for ND1) inflammasome activation (24). Bone marrow-derived macrophages (BMDMs) from Dnajc3^-/- mice showed stronger activation of PKR, NF-κB, and JNK with concomitant increased expression of pro-inflammatory genes TNF-α and IL-1β after treatment with lipopolysaccharide and ATP (24). The Dnajc3^-/-BMDMs showed increased NLRP3 inflammasome activation as indicated by increased caspase 1 cleavage and IL-1β secretion.

In addition to PKR, P58^IPK also inhibits the eIF2α kinase GCN2 (general control non-derepressible 2/eIF2α kinase 4) (25). P58^IPK overexpression resulted in reduced GCN2 phosphorylation and subsequent delayed eIF2α phosphorylation.

P58^IPK inhibits coxsackievirus B3 (CVB3)-induced apoptosis by the PI3K/Akt pathway, which requires the activation of ATF6 and upregulation of mitofusin 2 (26). Reduced expression of P58^IPK results in Akt-specific phosphorylation suppression and sensitized cells to CVB3-induced apoptosis. CVB3-infected cells that stably express P58^IPK showed suppressed apoptosis.

P58^IPK is a neuroprotective factor for retinal neurons (14). Dnajc3^-/- mice showed loss of retinal ganglion cells (RGCs) at 8 to 10 months of age. In wild-type mice, N-methyl-D-aspartic acid (NMDA)-induced retinal ER stress caused an increased in DnaJC3 expression. In Dnajc3^-/- mice NMDA-induced retinal ER stress caused increased RGC apoptosis. P58^IPK overexpression protected against oxidative and ER stress-induced apoptosis as well as reduced eIF2α phosphorylation, decreased CHOP expression, and alleviated the activation of caspase-3 and PARP.

P58^IPK mediates hepatocyte apoptosis and livery injury through PERK phosphorylation (27). Dnajc3^-/- mice fed a fat, fructose, and cholesterol-enriched diet exhibited reduced hepatocyte apoptosis, reduced expression of death receptors, reduced serum alanine transaminase values, reduced macrophage accumulation, and reduced fibrosis compared to wild-type controls (27).

P58^IPK functions in the maintenance of joint integrity through its regulation of PKR and PERK (28). Dnajc3^-/- mice exhibited joint degeneration as well as reduced total volume inside the femoral periosteal envelope as well as reduced tibial and femoral bone volumes.

Mutations in DNAJC3 are linked to combined cerebellar and peripheral ataxia with hearing loss and diabetes mellitus syndrome (ACPHD; OMIM: #616192) (16). Patients with ACPHD exhibit reduced weights and heights, delayed motor development, cognitive deficits, sensorineural hear loss, gait disturbances, demyelinating sensorimotor neuropathy, ataxia, juvenile-onset diabetes mellitus, and hypothyroidism (16;29).

Putative Mechanism

Dnajc3^-/- mice were smaller than control mice due to decreased body fat (30). Dnajc3^-/- mice exhibited glucosuria and hyperglycemia associated with decreased insulin resulting from increased apoptosis of pancreatic islet cells (30).  

Primers

PCR Primer
vanishing_pcr_F: CGTGCTTTAGAGACTCCTGTC
vanishing_pcr_R: CCAGAGTGATGGCTCAGTAGTG

Sequencing Primer
vanishing_seq_F: GCCCCATGCTTTAGAGACTCTG
vanishing_seq_R: TGTGTGCACTGAACAAGCATGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 413 nucleotides is amplified (chromosome 14, + strand):

1   cgtgctttag agactcctgt ctttcccccc agccccatgc tttagagact ctgtctctgt
61  attcaacagg tttctctgga ttaaggctag agaatttatt tgaaggcagg tcttgtgctc
121 tttccattta ctaagccacg cagtgaaagg agagggtggt ctgcagcttt ggaaatagtc
181 tcctagttac tcactggttg cttatttcat agatacacag atgcaaccag caaatatgaa
241 tcagtcatga aaacagagcc cagtgttgct gagtacacag tgcgctcgaa ggagaggatc
301 tgccactgct tctctaaggt aacagctgac gctcccagac agggaacagc agccacatgg
361 acttaaaatt cgcatgcttg ttcagtgcac acactactga gccatcactc tgg

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Barber, G. N., Thompson, S., Lee, T. G., Strom, T., Jagus, R., Darveau, A., and Katze, M. G. (1994) The 58-Kilodalton Inhibitor of the Interferon-Induced Double-Stranded RNA-Activated Protein Kinase is a Tetratricopeptide Repeat Protein with Oncogenic Properties. Proc Natl Acad Sci U S A. 91, 4278-4282.

  2. Lee, T. G., Tang, N., Thompson, S., Miller, J., and Katze, M. G. (1994) The 58,000-Dalton Cellular Inhibitor of the Interferon-Induced Double-Stranded RNA-Activated Protein Kinase (PKR) is a Member of the Tetratricopeptide Repeat Family of Proteins. Mol Cell Biol. 14, 2331-2342.

  3. Melville, M. W., Katze, M. G., and Tan, S. L. (2000) P58IPK, a Novel Cochaperone Containing Tetratricopeptide Repeats and a J-Domain with Oncogenic Potential. Cell Mol Life Sci. 57, 311-322.

  4. Boriushkin, E., Wang, J. J., and Zhang, S. X. (2014) Role of p58IPK in Endoplasmic Reticulum Stress-Associated Apoptosis and Inflammation. J Ophthalmic Vis Res. 9, 134-143.

  5. D'Andrea, L. D., and Regan, L. (2003) TPR Proteins: The Versatile Helix. Trends Biochem Sci. 28, 655-662.

  6. Das, A. K., Cohen, P. W., and Barford, D. (1998) The Structure of the Tetratricopeptide Repeats of Protein Phosphatase 5: Implications for TPR-Mediated Protein-Protein Interactions. EMBO J. 17, 1192-1199.

  7. Petrova, K., Oyadomari, S., Hendershot, L. M., and Ron, D. (2008) Regulated Association of Misfolded Endoplasmic Reticulum Lumenal Proteins with P58/DNAJc3. EMBO J. 27, 2862-2872.

  8. Gale, M.,Jr, Tan, S. L., Wambach, M., and Katze, M. G. (1996) Interaction of the Interferon-Induced PKR Protein Kinase with Inhibitory Proteins P58IPK and Vaccinia Virus K3L is Mediated by Unique Domains: Implications for Kinase Regulation. Mol Cell Biol. 16, 4172-4181.

  9. Gale, M.,Jr, Blakely, C. M., Hopkins, D. A., Melville, M. W., Wambach, M., Romano, P. R., and Katze, M. G. (1998) Regulation of Interferon-Induced Protein Kinase PKR: Modulation of P58IPK Inhibitory Function by a Novel Protein, P52rIPK. Mol Cell Biol. 18, 859-871.

  10. Svard, M., Biterova, E. I., Bourhis, J. M., and Guy, J. E. (2011) The Crystal Structure of the Human Co-Chaperone P58(IPK). PLoS One. 6, e22337.

  11. Tao, J., and Sha, B. (2011) Structural Insight into the Protective Role of P58(IPK) during Unfolded Protein Response. Methods Enzymol. 490, 259-270.

  12. Genevaux, P., Schwager, F., Georgopoulos, C., and Kelley, W. L. (2002) Scanning Mutagenesis Identifies Amino Acid Residues Essential for the in Vivo Activity of the Escherichia Coli DnaJ (Hsp40) J-Domain. Genetics. 162, 1045-1053.

  13. Yan, W., Frank, C. L., Korth, M. J., Sopher, B. L., Novoa, I., Ron, D., and Katze, M. G. (2002) Control of PERK eIF2alpha Kinase Activity by the Endoplasmic Reticulum Stress-Induced Molecular Chaperone P58IPK. Proc Natl Acad Sci U S A. 99, 15920-15925.

  14. Boriushkin, E., Wang, J. J., Li, J., Jing, G., Seigel, G. M., and Zhang, S. X. (2015) Identification of p58IPK as a Novel Neuroprotective Factor for Retinal Neurons. Invest Ophthalmol Vis Sci. 56, 1374-1386.

  15. Rutkowski, D. T., Kang, S. W., Goodman, A. G., Garrison, J. L., Taunton, J., Katze, M. G., Kaufman, R. J., and Hegde, R. S. (2007) The Role of p58IPK in Protecting the Stressed Endoplasmic Reticulum. Mol Biol Cell. 18, 3681-3691.

  16. Synofzik, M., Haack, T. B., Kopajtich, R., Gorza, M., Rapaport, D., Greiner, M., Schonfeld, C., Freiberg, C., Schorr, S., Holl, R. W., Gonzalez, M. A., Fritsche, A., Fallier-Becker, P., Zimmermann, R., Strom, T. M., Meitinger, T., Zuchner, S., Schule, R., Schols, L., and Prokisch, H. (2014) Absence of BiP Co-Chaperone DNAJC3 Causes Diabetes Mellitus and Multisystemic Neurodegeneration. Am J Hum Genet. 95, 689-697.

  17. van Huizen, R., Martindale, J. L., Gorospe, M., and Holbrook, N. J. (2003) P58IPK, a Novel Endoplasmic Reticulum Stress-Inducible Protein and Potential Negative Regulator of eIF2alpha Signaling. J Biol Chem. 278, 15558-15564.

  18. Polyak, S. J., Tang, N., Wambach, M., Barber, G. N., and Katze, M. G. (1996) The P58 Cellular Inhibitor Complexes with the Interferon-Induced, Double-Stranded RNA-Dependent Protein Kinase, PKR, to Regulate its Autophosphorylation and Activity. J Biol Chem. 271, 1702-1707.

  19. Korth, M. J., Edelhoff, S., Disteche, C. M., and Katze, M. G. (1996) Chromosomal Assignment of the Gene Encoding the Human 58-kDa Inhibitor (PRKRI) of the Interferon-Induced dsRNA-Activated Protein Kinase to Chromosome 13q32. Genomics. 31, 238-239.

  20. Lee, T. G., Tomita, J., Hovanessian, A. G., and Katze, M. G. (1990) Purification and Partial Characterization of a Cellular Inhibitor of the Interferon-Induced Protein Kinase of Mr 68,000 from Influenza Virus-Infected Cells. Proc Natl Acad Sci U S A. 87, 6208-6212.

  21. Goodman, A. G., Smith, J. A., Balachandran, S., Perwitasari, O., Proll, S. C., Thomas, M. J., Korth, M. J., Barber, G. N., Schiff, L. A., and Katze, M. G. (2007) The Cellular Protein P58IPK Regulates Influenza Virus mRNA Translation and Replication through a PKR-Mediated Mechanism. J Virol. 81, 2221-2230.

  22. Goodman, A. G., Tanner, B. C., Chang, S. T., Esteban, M., and Katze, M. G. (2011) Virus Infection Rapidly Activates the P58(IPK) Pathway, Delaying Peak Kinase Activation to Enhance Viral Replication. Virology. 417, 27-36.

  23. Goodman, A. G., Fornek, J. L., Medigeshi, G. R., Perrone, L. A., Peng, X., Dyer, M. D., Proll, S. C., Knoblaugh, S. E., Carter, V. S., Korth, M. J., Nelson, J. A., Tumpey, T. M., and Katze, M. G. (2009) P58(IPK): A Novel "CIHD" Member of the Host Innate Defense Response Against Pathogenic Virus Infection. PLoS Pathog. 5, e1000438.

  24. Boriushkin, E., Wang, J. J., Li, J., Bhatta, M., and Zhang, S. X. (2016) P58(IPK) Suppresses NLRP3 Inflammasome Activation and IL-1beta Production Via Inhibition of PKR in Macrophages. Sci Rep. 6, 25013.

  25. Roobol, A., Roobol, J., Bastide, A., Knight, J. R., Willis, A. E., and Smales, C. M. (2015) P58IPK is an Inhibitor of the eIF2alpha Kinase GCN2 and its Localization and Expression Underpin Protein Synthesis and ER Processing Capacity. Biochem J. 465, 213-225.

  26. Zhang, H. M., Qiu, Y., Ye, X., Hemida, M. G., Hanson, P., and Yang, D. (2014) P58(IPK) Inhibits Coxsackievirus-Induced Apoptosis Via the PI3K/Akt Pathway Requiring Activation of ATF6a and Subsequent Upregulation of Mitofusin 2. Cell Microbiol. 16, 411-424.

  27. Bandla, H., Dasgupta, D., Mauer, A. S., Nozickova, B., Kumar, S., Hirsova, P., Graham, R. P., and Malhi, H. (2018) Deletion of Endoplasmic Reticulum Stress-Responsive Co-Chaperone p58(IPK) Protects Mice from Diet-Induced Steatohepatitis. Hepatol Res. .

  28. Gilbert, S. J., Meakin, L. B., Bonnet, C. S., Nowell, M. A., Ladiges, W. C., Morton, J., Duance, V. C., and Mason, D. J. (2014) Deletion of P58(IPK), the Cellular Inhibitor of the Protein Kinases PKR and PERK, Causes Bone Changes and Joint Degeneration in Mice. Front Endocrinol (Lausanne). 5, 174.

  29. Bublitz, S. K., Alhaddad, B., Synofzik, M., Kuhl, V., Lindner, A., Freiberg, C., Schmidt, H., Strom, T. M., Haack, T. B., and Deschauer, M. (2017) Expanding the Phenotype of DNAJC3 Mutations: A Case with Hypothyroidism Additionally to Diabetes Mellitus and Multisystemic Neurodegeneration. Clin Genet. 92, 561-562.

  30. Ladiges, W. C., Knoblaugh, S. E., Morton, J. F., Korth, M. J., Sopher, B. L., Baskin, C. R., MacAuley, A., Goodman, A. G., LeBoeuf, R. C., and Katze, M. G. (2005) Pancreatic Beta-Cell Failure and Diabetes in Mice with a Deletion Mutation of the Endoplasmic Reticulum Molecular Chaperone Gene P58IPK. Diabetes. 54, 1074-1081.