Phenotypic Mutation 'vanishing' (pdf version)
List |< first << previous [record 40 of 132] next >> last >|
Allelevanishing
Mutation Type nonsense
Chromosome14
Coordinate118,972,387 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Dnajc3
Gene Name DnaJ heat shock protein family (Hsp40) member C3
Synonym(s) Dnajc3, Dnajc3a, Dnajc3b, mp58, p58IPK, Prkri
Chromosomal Location 118,937,976-118,981,697 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple tetratricopeptide repeat (TPR) motifs as well as the highly conserved J domain found in DNAJ chaperone family members. It is a member of the tetratricopeptide repeat family of proteins and acts as an inhibitor of the interferon-induced, dsRNA-activated protein kinase (PKR). [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice are smaller in size, have a lower percentage of body fat and develop a gradual onset of glucosuria and hyperglycemia associated with increasing apoptosis of pancreatic islet cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008929; MGI:107373

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022734]
PDB Structure
Crystal Structure of P58(IPK) TPR Domain at 2.5 A [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000022734
Gene: ENSMUSG00000022136
AA Change: Y291*

DomainStartEndE-ValueType
TPR 37 70 2.02e1 SMART
TPR 71 104 2.52e-1 SMART
TPR 105 138 4.99e-5 SMART
TPR 188 221 1.16e0 SMART
TPR 222 255 4.96e0 SMART
TPR 306 339 4.1e1 SMART
TPR 340 373 6.58e-5 SMART
DnaJ 393 454 6.88e-26 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased 15793246
Body Weight (Female) - decreased 15793246
Body Weight (Male) - decreased 15793246
DSS: sensitive day 10
DSS: sensitive day 7
FACS CD44+ CD8 T cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(16) : Chemically induced (other)(1) Gene trapped(11) Radiation induced(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Dnajc3 APN 14 118960862 critical splice donor site probably null
R1438:Dnajc3 UTSW 14 118968106 missense probably benign
R1712:Dnajc3 UTSW 14 118957895 missense probably damaging 1.00
R2257:Dnajc3 UTSW 14 118972702 missense probably benign
R2261:Dnajc3 UTSW 14 118960820 missense probably damaging 0.98
R2262:Dnajc3 UTSW 14 118960820 missense probably damaging 0.98
R2307:Dnajc3 UTSW 14 118953221 critical splice donor site probably null
R4963:Dnajc3 UTSW 14 118978173 missense probably benign 0.06
R4996:Dnajc3 UTSW 14 118972427 missense probably benign
R5398:Dnajc3 UTSW 14 118972387 nonsense probably null
R5539:Dnajc3 UTSW 14 118970747 missense probably damaging 0.98
R5988:Dnajc3 UTSW 14 118957964 missense possibly damaging 0.54
R6032:Dnajc3 UTSW 14 118968031 missense possibly damaging 0.69
R6032:Dnajc3 UTSW 14 118968031 missense possibly damaging 0.69
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-14 2:14 PM by Anne Murray
Record Created 2017-08-16 3:28 PM by Bruce Beutler
Record Posted 2018-09-14
Phenotypic Description

Figure 1. Vanishing mice exhibited reduced body weights compared to wild-type littermates. Scaled weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Vanishing mice exhibited increased susceptibility to dextran sodium sulfate (DSS)-induced colitis. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Vanishing mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Vanishing mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Vanishing mice exhibit increased frequencies of peripheral CD44+ CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The vanishing phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5398, some of which showed reduced body weights compared to wild-type littermates (Figure 1). Some mice also showed susceptibility to dextran sodium sulfate (DSS)-induced colitis (Figure 2) as well as increased frequencies of T cells (Figure 3), CD4+ T cells (Figure 4), and CD44+ CD8 T cells (Figure 5) in the peripheral blood.

Nature of Mutation
 

Figure 6. Linkage mapping of the increased CD44+ CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 55 mutations (X-axis) identified in the G1 male of pedigree R5398. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 55 mutations. All of the above anomalies were linked to a mutation in Dnajc3: a T to A transversion at base pair 118,972,387 (v38) on chromosome 14, or base pair 34,456 in the GenBank genomic region NC_000080 encoding Dnajc3. The strongest association as found with a recessive model of inheritance to the CD44+ CD8 T cell frequency, wherein three variant homozygotes departed phenotypically from seven homozygous reference mice and 23 heterozygous mice with a P value of 1.061 x 10-6 (Figure 6). 

 

The mutation corresponds to residue 1,030 in the mRNA sequence NM_008929 within exon 8 of 12 total exons.

 

1013 GATGCAACCAGCAAATATGAATCAGTCATGAAA

286  -D--A--T--S--K--Y--E--S--V--M--K-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 291 for a premature stop codon (Y291*) in the DNAJC3 protein.

Protein Prediction
Figure 7. Domain structure of P58IPK. The vanishing mutation results in the substitution of tyrosine 291 for a premature stop codon. Abbreviations: TPR, tetratricopeptide repeat.
Figure 8. Crystal structure of human P58IPK. The relative location of the vanishing mutation is noted. Figure generated by UCSF Chimera and is based on PDB:2Y4U.

Dnajc3 encodes P58IPK (alternatively, DnaJC3 or PRKRI), a member of the DnaJ subfamily of the HSP40 (alternatively, J) family of chaperones. P58IPK has nine tetratricopeptide repeat (TPR) motifs near the N-terminus, a flexible linker region, and a highly conserved J (alternatively, DnaJ) domain at the C-terminus (Figure 7) (1-3). The J domain and a conserved Hsp70-binding histidine-proline-aspartate (HPD) motif mediate its interaction with Hsp70/BiP. An N-terminal ER-targeting signal domain mediates translocation of P58IPK from the cytosol to the ER (4).

 

TPRs are 34-amino acid motifs that mediate protein-protein interactions and the assembly of multiprotein complexes (3;5-7). TPR motifs 1 to 4 of P58IPK promote self-interaction (8). The sixth TPR motif of P58IPK interacts with the interferon-induced double-stranded RNA-activated protein kinase (PKR; alternatively, eukaryotic translation initiation factor 2-alpha kinase 2 [Eif2ak2]) (8). The seventh TPR motif of P58IPK interacts with P52rIPK (52-kDa repressor of the inhibitor of protein kinase) (9).

 

The structure of human P58IPK (minus the last 43 amino acids) has been solved [Figure 8; PDB:2Y4U; (10)]. P58IPK is an elongated protein comprised entirely of α-helices. The HPD motif is at the very edge of the elongated protein. The nine TPR motifs are comprised of 19 α-helices in a helix-turn-helix arrangement. They are separated into three subdomains: TPR1 through TPR3 (helices 1 through 7), TPR4 through TPR6 (helices 7 through 13), and TPR7 through TPR9 (helices 13 through 19) (10). A hydrophobic patch in subdomain I putatively binds misfolded proteins (e.g., luciferase, rhodanese, and insulin) (11). The J domain is comprised of four helices. The second helix of the J domain has basic residues that can facilitate binding to the ATPase domain of BiP (10;12)].

 

The vanishing mutation results in substitution of tyrosine 291 for a premature stop codon (Y291*) in the DNAJC3 protein; amino acid 291 is within the seventh TPR motif.

Expression/Localization

DNAJC3 is ubiquitously expressed (NCBI). Dnajc3 expression is induced by ER stress (13). In the retina, P58IPK is expressed predominantly in retinal ganglion cells (RGC), inner retinal neurons, and the photoreceptor inner segments (14). P58IPK is localized to the ER lumen (15).

Background

Figure 9. P58IPK functions in the unfolded protein response (UPR). The UPR promotes protein folding through the synthesis of ER resident chaperones as well as enhanced ER-associated protein degradation (ERAD) and global repression of protein synthesis. Three ER resident transmembrane proteins, IRE1, protein kinase RNA (PKR)-like ER kinase/pancreatic eIF2α kinase (PERK), and activating transcription factor 6 (ATF6) mediate UPR signaling. IRE1 senses ER stress and transmits a signal to the nucleus by initiating spliceosome-independent splicing of Xbp1, a basic leucine zipper transcriptional regulator of the UPR. The mature from of XBP1 facilitates the upregulation of several gene products  including ER-resident proteins that will assist in protein folding and maturation as well as ER-associated proteins that will assist in protein degradation. Upon recognition of misfolded proteins in the ER, PERK phosphorylates the translation initiation factor eIF2α that inhibits global protein synthesis by blocking the formation of an active 43S translation-initiation complex. S1P cleaves ATF6, a transcription factor activated by ER stress. Under normal conditions, ATF6 is held in the ER by interactions with the chaperone, GRP78. Accumulation of misfolded proteins in the ER leads to ER stress and the subsequent release of ATF6 from GRP78. The dissociation of GRP78 exposes a Golgi localization sequence on ATF6 that targets ATF6 to the Golgi via COPII vesicles. Within the Golgi, ATF6 is cleaved by S1P and S2P to free the basic leucine zipper and transactivation domain (TA) of ATF6 to translocate to the nucleus where it binds to ER stress responsive elements (ERSE) to activate unfolded protein response (UPR) genes.

Accumulation of misfolded proteins in the ER lumen, glucose starvation, inhibition of protein glycosylation, and disturbance of intracellular calcium stores results in ER stress. To alleviate ER stress and to restore the ER to its normal state, a series of signaling pathways, termed the unfolded protein response (UPR) promotes protein folding through the synthesis of ER resident chaperones (e.g., BiP/GRP78 and GRP94) and folding catalysts as well as enhanced ER-associated protein degradation (ERAD) and global repression of protein synthesis (Figure 9). Three ER resident transmembrane proteins, IRE1 (see the record for ernie), protein kinase RNA (PKR)-like ER kinase/pancreatic eIF2α kinase (PERK), and activating transcription factor 6 (ATF6) mediate UPR signaling. Upon recognition of misfolded proteins in the ER, PERK phosphorylates the translation initiation factor eIF2α that inhibits global protein synthesis by blocking the formation of an active 43S translation-initiation complex (i.e., 40S subunit, eIF1, eIF1A, eIF3, eIF2-GTP-Met-tRNAMet, and eIF5).

 

P58IPK is a co-chaperone of BiP (11;15;16). P58IPK binds unfolded or misfolded proteins and delivers them to BiP (11). P58IPK is also a putative negative regulator of eIF2α signaling during the UPR (17). Reduced P58IPK expression inhibited eIF2α phosphorylation and caused reduced expression of eIF2α targets. P58IPK binds PERK, which controls PERK-dependent phosphorylation of eIF2 during the UPR (13).

 

P58IPK is also an inhibitor of PKR (18-21). P58IPK binding to PKR regulates its autophosphorylation and activity (18). PKR, upon activation by dsRNA, phosphorylates eIF2α, leading to decreased synthesis of host and viral proteins. The virus recruits P58IPK to inactivate PKR, so that viral protein synthesis can continue and increase (20-22). P58IPK binding to PKR is inhibited by interaction with P52rIPK (9). Although P58IPK prolongs viral replication, it inhibits virus-induced apoptosis and inflammation to prolong host survival (23). Dnajc3-deficient (Dnajc3-/-) mice infected with influenza virus showed increased lung pathology, immune cell apoptosis, PKR activation, and mortality (23). The expression of cell death, immune, and inflammation genes was increased in the influenza-infected Dnajc3-/- mice.

 

Through its inhibition of PKR, P58IPK suppresses NLRP3 (see the record for ND1) inflammasome activation (24). Bone marrow-derived macrophages (BMDMs) from Dnajc3-/- mice showed stronger activation of PKR, NF-κB, and JNK with concomitant increased expression of pro-inflammatory genes TNF-α and IL-1β after treatment with lipopolysaccharide and ATP (24). The Dnajc3-/-BMDMs showed increased NLRP3 inflammasome activation as indicated by increased caspase 1 cleavage and IL-1β secretion.

 

In addition to PKR, P58IPK also inhibits the eIF2α kinase GCN2 (general control non-derepressible 2/eIF2α kinase 4) (25). P58IPK overexpression resulted in reduced GCN2 phosphorylation and subsequent delayed eIF2α phosphorylation.

 

P58IPK inhibits coxsackievirus B3 (CVB3)-induced apoptosis by the PI3K/Akt pathway, which requires the activation of ATF6 and upregulation of mitofusin 2 (26). Reduced expression of P58IPK results in Akt-specific phosphorylation suppression and sensitized cells to CVB3-induced apoptosis. CVB3-infected cells that stably express P58IPK showed suppressed apoptosis.

 

P58IPK is a neuroprotective factor for retinal neurons (14). Dnajc3-/- mice showed loss of retinal ganglion cells (RGCs) at 8 to 10 months of age. In wild-type mice, N-methyl-D-aspartic acid (NMDA)-induced retinal ER stress caused an increased in DnaJC3 expression. In Dnajc3-/- mice NMDA-induced retinal ER stress caused increased RGC apoptosis. P58IPK overexpression protected against oxidative and ER stress-induced apoptosis as well as reduced eIF2α phosphorylation, decreased CHOP expression, and alleviated the activation of caspase-3 and PARP.

 

P58IPK mediates hepatocyte apoptosis and livery injury through PERK phosphorylation (27). Dnajc3-/- mice fed a fat, fructose, and cholesterol-enriched diet exhibited reduced hepatocyte apoptosis, reduced expression of death receptors, reduced serum alanine transaminase values, reduced macrophage accumulation, and reduced fibrosis compared to wild-type controls (27).

 

P58IPK functions in the maintenance of joint integrity through its regulation of PKR and PERK (28). Dnajc3-/- mice exhibited joint degeneration as well as reduced total volume inside the femoral periosteal envelope as well as reduced tibial and femoral bone volumes.

 

Mutations in DNAJC3 are linked to combined cerebellar and peripheral ataxia with hearing loss and diabetes mellitus syndrome (ACPHD; OMIM: #616192(16). Patients with ACPHD exhibit reduced weights and heights, delayed motor development, cognitive deficits, sensorineural hear loss, gait disturbances, demyelinating sensorimotor neuropathy, ataxia, juvenile-onset diabetes mellitus, and hypothyroidism (16;29).

Putative Mechanism

Dnajc3-/- mice were smaller than control mice due to decreased body fat (30)Dnajc3-/- mice exhibited glucosuria and hyperglycemia associated with decreased insulin resulting from increased apoptosis of pancreatic islet cells (30).  

Primers PCR Primer
vanishing(F):5'- CGTGCTTTAGAGACTCCTGTC -3'
vanishing(R):5'- CCAGAGTGATGGCTCAGTAGTG -3'

Sequencing Primer
vanishing_seq(F):5'- GCCCCATGCTTTAGAGACTCTG -3'
vanishing_seq(R):5'- TGTGTGCACTGAACAAGCATGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer, Zhao Zhang, and Bruce Beutler
List |< first << previous [record 40 of 132] next >> last >|