Phenotypic Mutation 'tardive' (pdf version)
List |< first << previous [record 11 of 132] next >> last >|
Alleletardive
Mutation Type nonsense
Chromosome17
Coordinate57,303,079 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Vav1
Gene Name vav 1 oncogene
Chromosomal Location 57,279,100-57,328,031 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011691, NM_001163815, NM_001163816; MGI:98923

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005889] [ENSMUSP00000108491] [ENSMUSP00000126694]
PDB Structure
NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR]
CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION]
Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR]
Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR]
CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: K444*

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: K444*

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: K420*

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1 cells - decreased 9601639
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased 9601639
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 9601639
FACS CD8+ T cells in CD3+ T cells - decreased 9601639
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS IgD MFI - decreased
FACS IgM MFI - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS T cells - decreased 19009524
ratio of OVA-specific IgE over the total IgE - increased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
total IgE level - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(1) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-10-25 5:47 PM by Diantha La Vine
Record Created 2017-08-18 9:39 AM by Bruce Beutler
Record Posted 2018-06-13
Phenotypic Description

Figure 1. Tardive mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Tardive mice exhibit increased CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Tardive mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Tardive mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Tardive mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Tardive mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Tardive mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Tardive mice exhibit decreased frequencies of peripheral niave CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Tardive mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Tardive mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Tardive mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Tardive mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Tardive mice exhibit reduced expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Tardive mice exhibit increased expression of IgM on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Tardive mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Tardive mice exhibit increased expression of CD44 on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Tardive mice exhibit increased expression of CD44 on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 18. Homozygous tardive mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The tardive phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5503, some of which showed an increase in the B to T cell ratio (Figure 1), an increased in the CD4+ to CD8+ T cell ratio (Figure 2), reduced frequencies of B1 cells (Figure 3), T cells (Figure 4), CD4+ T cells (Figure 5), CD8+ T cells (Figure 6), CD8+ T cells in CD3+ T cells (Figure 7), naive CD4 T cells in CD4 T cells (Figure 8), and naive CD8 T cells in CD8 T cells (Figure 9) with concomitant increased frequencies of central memory CD4 T cells in CD4 T cells (Figure 10), central memory CD8 T cells in CD8 T cells (Figure 11), and effector memory CD4 T cells in CD4 T cells (Figure 12). Expression of IgD on peripheral B cells was reduced (Figure 13), but expression of IgM on peripheral B cells was increased (Figure 14). Expression of CD44 on peripheral T cells (Figure 15), CD4+ T cells (Figure 16), and CD8+ T cells (Figure 17) was increased. The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 18).

Nature of Mutation

Figure 19. Linkage mapping of the increased B to T cell ratio using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 99 mutations (X-axis) identified in the G1 male of pedigree R5503. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 99 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Vav1:  an A to T transversion at base pair 57,303,079 (v38) on chromosome 17, or base pair 24,001 in the GenBank genomic region NC_000083.  The strongest association was found with a recessive model of linkage to the normalized B to T cell ratio, wherein five variant homozygotes departed phenotypically from 18 homozygous reference mice and 24 heterozygous mice with a P value of 3.933 x 10-29 (Figure 19). A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 1,428 in the mRNA sequence NM_011691 within exon 14 of 27 total exons.


 
1413 GACTCTTACGACCTCAAAGCCTCGGTGAACTTG
439  -D--S--Y--D--L--K--A--S--V--N--L-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 444 for a premature stop codon (K444*) in the VAV1 protein.

Protein Prediction
Figure 20. Domain structure of VAV1. The tardive mutation results in substitution of lysine 444 for a premature stop codon in the VAV1 protein. Other mutations in VAV1 are noted. Click on each mutation to view more information.
Figure 21. Crystal structure of VAV1. Figure generated by UCSF Chimera and is based on PDB:3KY9.

Vav1 has several domains, including a calponin-homology (CH) domain, an acidic (Ac) motif, a DBL homology (DH) domain, a pleckstrin homology (PH) domain, a phorbol-ester/DAG-type zinc finger (alternatively, C1 domain), a proline-rich region, a Src homology 2 (SH2) domain, and two Src homology 3 (SH3) domains [PDB: 3KY9; (1;2); reviewed in (3)]. Vav1 also has two nuclear localization sequences. The functions of the Vav1 domains are detailed, below.

 

Each of the Vav1 domains has a unique function. The exact function of the CH domain of Vav1 is unknown; however, it is associated with the induction of calcium release putatively by promoting the activation of phospholipase C-γ (PLCγ; see the record for queen) (4). Several proteins interact with the CH domain (Table 1), but it is unknown if any of these proteins promote Vav1-associated calcium release (5;6). The Ac motif contains three regulatory tyrosines: Tyr142, Tyr160, and Tyr174 (in mouse). Tyr174 binds the GTPase interaction pocket of the DH domain to control the guanine exchange factor (GEF) activity of Vav1 towards the Rho family GTPases Rac1, Rac2 (see the record for bingo), Cdc42, and RhoA . Phosphorylation of Tyr174 after receptor stimulation releases it from the binding pocket and alleviates the autoinhibition (2;7). The DH domain of Vav1 facilitates its GEF activity (8). The PH domain interacts with polyphosphoinositides, promoting Vav1 localization to the plasma membrane and regulation of its GEF activity (9;10). The ZF/C1, proline-rich, SH2, and SH3 domains all mediate protein-protein interactions (Table 1) (9). The outcomes of most of the protein-protein interactions are unknown, but many promote Vav1 function in multiple signaling pathways.

 

Table 1. Vav1 interacting proteins

Vav1 interacting domain

Interacting protein

Brief Description

References

CH

Socs1

Component of the Kit receptor (see the record for Pretty2) signaling pathway

(11)

ENX-1

Transcriptional regulator of homeobox gene expression

(12)

LyGDI

Regulator of Rho GTPases

(13)

RhoGDI

Regulator of Rho GTPases

 

Calmodulin

Calcium-binding messenger protein

(6)

SH2

ZAP70

Tyrosine kinase (see the record for murdock)

(14)

Syk

Tyrosine kinase (see the record for poppy)

(15)

SLP76

Adaptor protein

(16)

BLNK

Adaptor protein (see the record for busy)

(17)

N-terminal SH3

Grb2

Adaptor protein; necessary for Vav1 translocation to the plasma membrane

(5;18)

C-terminal SH3

Zyxin

Cytoskeletal regulators

(19)

hnRNP-K

RNA-binding protein

(20)

hnRNP-C

RNA-binding protein

 

Sam68

RNA-binding protein

(21)

VIK-1

Kruppel-like protein

(22)

Dynamin-2

GTPase; stabilizes Vav1, subsequently potentiating the invasive migration of pancreatic tumor cells; putatively transduces Vav1 signals to numerous signaling pathways

(23)

Nef

Human immunodeficiency virus type 1 protein

(24)

Transcriptional modulators

 

(5;25;26)

Ubiquitination factors

 

 

The tardive mutation results in substitution of lysine 444 for a premature stop codon (K444*) in the VAV1 protein; amino acid 444 is within the PH domain.

Expression/Localization

Vav1 is only expressed in hematopoietic tissues, including spleen, thymus, lymph nodes, and bone marrow (1;25). Vav1 is typically localized to the cytoplasm, but can translocate to the nucleus to function in transcription (25).

 

Vav1 expression has also been detected in several human cancers, including neuroblastomas (27), pancreatic ductal adenocarcinoma (28), lung cancer (29), breast cancer (30), ovarian cancer, prostate cancer (31), medulloblastomas (32), and B-CLL (33).

Background

Figure 23. TCR Signaling. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors. This image is interactive. Click on the image to view mutations found within the pathway. Click on each mutation for more information.

Figure 24. Pre-BCR and BCR signaling. Pre-BCR engagement results in the activation of SYK (spleen tyrosine kinase), which together with Src-family  kinases (LYN, FYN, BLK), phosphorylates many substrates and triggering signaling pathways that are involved in both proliferation and differentiation of pre-B cells. These include activation of phosphoinositide 3 kinase (PI3K) by phosphorylating the coreceptor CD19 and/or the adaptor protein B-cell PI3K adaptor (BCAP). PI3K activation results in the generation of phosphatidylinosital-3,4,5-triphosphate (PIP3), which recruits plekstrin-homology domain signaling molecules to the membrane including the serine threonine protein kinase B (PKB) and its activating kinase 3- phosphoinositide-dependent protein kinase 1 (PDK1). Signaling through this pathway pathway suppresses recombination-activating gene 1 (RAG1) and RAG2 expression, blocks Igk (the k chain of the immunoglobin light chain) gene recombination and induces cell proliferation. SYK also phosphorylates SH2-domain containing leukocyte protein of SLP65, resulting in the organization of a molecular complex that includes Bruton’s tyrosine kinase (BTK) and phospholipase Cg2 (PLCg2). This complex controls downregulation of l-5, a component of the surrogate light chain (SLC), and upregulates the expression of RAG proteins and the interferon-regulatory factor 4 (IRF4). IRF4 positively regulates Igk recombination. SLP65 also modulates PKB activity either directly or by altering the activity of SYK, CD19, or PI3K. Alternatively, SLP65 may regulate PKB activity by activating lipid phosphatases such as SH2-domain containing inositol-5 phosphate (SHIP) and altering PIP3 levels. Multiple downstream signaling pathways are activated by BCR stimulation and lead to a multitude of cellular responses. Following aggregation and localization of BCR molecules, the tails of Igα and Igβ become phosphorylated by Src family kinases (typically Lyn) and by SYK. These phosphotyrosines then act as docking sites for the SH2 domains of SYK, resulting in SYK phosphorylation and activation. SYK phosphorylates a number of downstream targets including BLNK, PLC-g2 and protein kinase C β (PKCβ). BCR stimulation also activates phosphatidylinositol 3 kinase (PI3K) resulting in the generation of 3′-phosphorylated phosphoinositides. One of these lipids, phosphatidylinositol-3,4,5-triphosphate (PIP3), binds selectively to the pleckstrin homology (PH) domain of Btk, facilitating membrane recruitment of the kinase. Phosphorylated BLNK also provides docking sites for Btk, as well as PLC-g2, which results in the additional phosphorylation and activation of PLC-γ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). Soluble IP3 and membrane-bound DAG initiate downstream signal transduction pathways involving calcium (Ca2+) mobilization and PKC, respectively. The recruitment of Vav, Nck and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), nuclear factor (NF)-κB and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation and apoptosis, as well as the secretion of antigen-specific antibodies. Other molecules that play important roles in BCR signaling include Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1 or CARD11), which are involved in NF-κB activation along with PKCβ. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.This image is interactive. Click on the image to view mutations found within the pathway. Click on each mutation for more information.

Vav1 is a guanine nucleotide exchange factor (GEF) for Rho family GTPases. Vav1 is essential for hematopoiesis, including T- and B-cell development and activation (34-36). Vav1 also functions in the adhesion, migration, and phagocytosis of mature hematopoietic cells by regulating cytoskeletal rearrangement [reviewed in (37)]. In NK cells, the Vav1 GEF activity is required for activation of NK-associated killing (38). Vav1 has several functions in macrophages, including Rac-dependent complement-mediated phagocytosis (39), cell migration (40), and chemotaxis to CSF-1 (41).

 

Vav1 functions downstream of several immune receptors, including the T-cell receptor (TCR) (42), B-cell receptor (BCR) (43), natural killer (NK) receptors (44), FcRI (45), cytokine receptors (46), chemokine receptors (47), and integrins (48).  The function of Vav1 in TCR and BCR-associated signaling is described in more detail, below.

 

In T cell receptor-associated signaling, ligand binding promotes the recruitment of the tyrosine kinases Lck (see the record for Lemon) and Fyn to the receptor complex. CD45 dephosphorylates C-terminal inhibitory tyrosine residues on Lck and Fyn, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2 (Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1. SLP-76 binds Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk; see the record for itxaro), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1) after Syk-mediated SLP-76 phosphorylation. This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways. In B cell receptor-mediated signaling, the recruitment of Vav1, Nck, and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK). Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for puffxander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies. 

 

Following BCR ligation, Blk and/or Lyn phosphorylates the ITAMs of the Igα (see the record for crab)/Igβ BCR subunits (49;50). These phosphotyrosines then act as docking sites for the SH2 domains of Syk, resulting in Syk phosphorylation and activation. Syk phosphorylates a number of downstream targets including BLNK, PLCγ2, and protein kinase C β (PKCβ; see the record for Untied). Phosphorylated BLNK also provides docking sites for Btk, as well as PLCγ2, which results in the additional phosphorylation and activation of PLCγ2 by Btk leading to the hydrolysis of phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (51). The recruitment of Vav1, Nck, and Ras by BLNK to the BCR activates MAP kinase cascades such as JNK, p38 and extracellular signal regulated kinase (ERK) [reviewed in (52)]. Together, these signals allow the activation of multiple transcription factors, including nuclear factor of activated T cells (NF-AT), NF-κB (see the records for finlay, xander and panr2) and AP-1, which subsequently regulate biological responses including cell proliferation, differentiation, and apoptosis as well as the secretion of antigen-specific antibodies [reviewed in (53)].

 

Vav1 is a binding partner of Nef proteins from HIV-1 (54). Binding of VAV1 and Nef results in morphological changes, cytoskeletal rearrangements, and activation of the JNK/SAPK signaling cascade, subsequently leading to increased viral transcription and replication.

 

Vav1 putatively functions in malignancies, including neuroblastoma, melanoma, pancreatic tumors and B-cell chronic lymphocytic leukemia. Patients with Vav1-positive tumors had a worse prognosis than patients with Vav1-negative tumors (28). High amounts of nuclear Vav1 in early invasive breast tumors were positively correlated with a low incidence of relapse (31). The link between Vav1 and cancer is unclear, but it has been attributed to its GEF activity towards Rho/RacGTPases, which regulate cytoskeleton organization, gene transcription, cell proliferation, migration, growth, and survival (55;56). Additional links between Vav1 and cancer include Vav1-stimulated MAPK signaling, Vav1-regulated growth factor (e.g., CSF-1) expression (57), Vav1-associated cell cycle progression and gene transcription, Vav1-associated synergistic signaling cross-talk between cancer cells and the tumor microenvironment (58), and Vav1-stimulated autocrine ligand secretion (59).

 

In the nucleus, Vav1 interacts with components of the DNA-dependent protein kinase complex and with hnRNP proteins as part of transcriptionally active complexes (60-62).

Putative Mechanism

Vav1-deficient (Vav1-/-) mice exhibited embryonic lethality between embryonic day (E) 3.5 and E7.5 (63). A second Vav1-/- mouse model was viable, and exhibited impaired negative T cell selection (64). Single-positive (namely CD4+ T cells), double-positive, and double-negative T cell numbers as well as the number of mature B cells and B1 cells were reduced in the Vav1-/- mice (65-70). T cells from the Vav1-/- mice showed reduced proliferative responses to anti-CD3 stimulation as well as reduced T cell receptor-induced calcium fluxes (64;66;67). The T-dependent IgG response to VSV infection and to NIP-OVA was reduced (70). Homozygous mice expressing an ENU-induced Vav1 allele (F203S) exhibited increased numbers of T cells after immunization (MGI; accessed September 14, 2017).

Primers PCR Primer
tardive(F):5'- GGTTAAGGTTAGGATGCGAACC -3'
tardive(R):5'- AGGCTGTCTAGACCATCCAAAC -3'

Sequencing Primer
tardive_seq(F):5'- GTTAGGATGCGAACCCACAGC -3'
tardive_seq(R):5'- GAGGTTGCCTCTGAACTCTAAC -3'
References
Science Writers Anne Murray
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 11 of 132] next >> last >|