Phenotypic Mutation 'Plain_sight' (pdf version)
AllelePlain_sight
Mutation Type missense
Chromosome17
Coordinate57,297,122 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Vav1
Gene Name vav 1 oncogene
Chromosomal Location 57,279,100-57,328,031 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011691, NM_001163815, NM_001163816; MGI:98923

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005889] [ENSMUSP00000108491] [ENSMUSP00000126694]
PDB Structure
NMR STRUCTURE OF THE Y174 AUTOINHIBITED DBL HOMOLOGY DOMAIN [SOLUTION NMR]
CRYSTAL STRUCTURE OF VAV SH3 DOMAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF VAV AND GRB2 SH3 DOMAINS [X-RAY DIFFRACTION]
Solution structure of N-terminal SH3 domain mutant(P33G) of murine Vav [SOLUTION NMR]
Attachment of an NMR-invisible solubility enhancement tag (INSET) using a sortase-mediated protein ligation method [SOLUTION NMR]
CRITICAL STRUCTURAL ROLE FOR THE PH AND C1 DOMAINS OF THE VAV1 EXCHANGE FACTOR [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: E175K

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000005889)
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: E175K

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000112870)
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: E151K

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000169220)
Meta Mutation Damage Score 0.3360 question?
Is this an essential gene? Possibly nonessential (E-score: 0.382) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - decreased 9601639
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.572
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(1) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
finally UTSW 17 57311860 nonsense probably null
Last UTSW 17 57296039 missense probably damaging 0.99
Late UTSW 17 57301870 missense possibly damaging 0.91
tardive UTSW 17 57303079 nonsense probably null
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5503:Vav1 UTSW 17 57303079 nonsense probably null
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
R7335:Vav1 UTSW 17 57296720 missense probably benign
R7474:Vav1 UTSW 17 57299102 missense probably benign 0.07
R7665:Vav1 UTSW 17 57297086 missense probably damaging 1.00
Z1176:Vav1 UTSW 17 57303853 missense probably damaging 1.00
Z1177:Vav1 UTSW 17 57303040 missense probably benign 0.18
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2019-09-04 9:39 PM by Diantha La Vine
Record Created 2017-08-21 8:21 AM by Bruce Beutler
Record Posted 2018-06-13
Phenotypic Description

Figure 1. Plain_sight mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Plain_sight phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5240, some of which showed reduced frequencies of B1 cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced B1 cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 67 mutations (X-axis) identified in the G1 male of pedigree R5240. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 67 mutations. The B1 cell phenotype was linked by continuous variable mapping to a mutation in Vav1:  a G to A transition at base pair 57,297,122 (v38) on chromosome 17, or base pair 18,044 in the GenBank genomic region NC_000083. Linkage was found with an additive model of inheritance, wherein nine variant homozygotes and 35 heterozygous mice departed phenotypically from 16 homozygous reference mice with a P value of 1.71 x 10-5 (Figure 2). 

 

The mutation corresponds to residue 621 in the mRNA sequence NM_011691 within exon 5 of 27 total exons.


 

606 GGGGACGAGATCTACGAGGACCTAATGCGCTTG

170 -G--D--E--I--Y--E--D--L--M--R--L-

 

The mutated nucleotide is indicated in red. The mutation results in a glutamic acid to lysine substitution at amino acid 175 (E175K) in the VAV1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 3. Domain structure of VAV1. The Plain_sight mutation results in a glutamic acid to lysine substitution at amino acid 175 in the VAV1 protein. Other mutations in VAV1 are noted. Click on each mutation to view more information.

Vav1 has several domains, including a calponin-homology (CH) domain, an acidic (Ac) motif, a DBL homology (DH) domain, a pleckstrin homology (PH) domain, a phorbol-ester/DAG-type zinc finger (alternatively, C1 domain), a proline-rich region, a Src homology 2 (SH2) domain, and two Src homology 3 (SH3) domains [PDB: 3KY9; (1;2); reviewed in (3)]. Vav1 also has two nuclear localization sequences.

 

The Plain_sight mutation results in a glutamic acid to lysine substitution at amino acid 175 (E175K). Amino acid 175 is within the Ac motif. The Ac motif contains three regulatory tyrosines: Tyr142, Tyr160, and Tyr174 (in mouse). Tyr174 binds the GTPase interaction pocket of the DH domain to control the guanine exchange factor (GEF) activity of Vav1 towards the Rho family GTPases Rac1, Rac2 (see the record for bingo), Cdc42, and RhoA . Phosphorylation of Tyr174 after receptor stimulation releases it from the binding pocket and alleviates the autoinhibition (2;4).

 

Please see the record tardive for more information about Vav1.

Putative Mechanism

Vav1 is a guanine nucleotide exchange factor (GEF) for Rho family GTPases. Vav1 is essential for hematopoiesis, including T- and B-cell development and activation (5-7). Vav1 also functions in the adhesion, migration, and phagocytosis of mature hematopoietic cells by regulating cytoskeletal rearrangement [reviewed in (8)]. In NK cells, the Vav1 GEF activity is required for activation of NK-associated killing (9). Vav1 has several functions in macrophages, including Rac-dependent complement-mediated phagocytosis (10), cell migration (11), and chemotaxis to CSF-1 (12).

 

Vav1 functions downstream of several immune receptors, including the T-cell receptor (TCR) (13), B-cell receptor (BCR) (14), natural killer (NK) receptors (15), FcRI (16), cytokine receptors (17), chemokine receptors (18), and integrins (19)

Vav1 is a binding partner of Nef proteins from HIV-1 (20). Binding of VAV1 and Nef results in morphological changes, cytoskeletal rearrangements, and activation of the JNK/SAPK signaling cascade, subsequently leading to increased viral transcription and replication.

 

Vav1-deficient (Vav1-/-) mice exhibited embryonic lethality between embryonic day (E) 3.5 and E7.5 (21). A second Vav1-/- mouse model was viable, and exhibited impaired negative T cell selection (22). Single-positive (namely CD4+ T cells), double-positive, and double-negative T cell numbers as well as the number of mature B cells and B1 cells were reduced in the Vav1-/- mice (23-28). T cells from the Vav1-/- mice showed reduced proliferative responses to anti-CD3 stimulation as well as reduced T cell receptor-induced calcium fluxes (22;24;25). The T-dependent IgG response to VSV infection and to NIP-OVA was reduced (28). Homozygous mice expressing an ENU-induced Vav1 allele (F203S) exhibited increased numbers of T cells after immunization (MGI; accessed September 14, 2017).

Primers PCR Primer
Plain_sight_pcr_F: GTTTAAGGTGACACATTGCAAGAC
Plain_sight_pcr_R: GGAGCCCAGTGTGTCTGTATAC

Sequencing Primer
Plain_sight_seq_F: TGACACATTGCAAGACGTGGG
Plain_sight_seq_R: GAGCCCAGTGTGTCTGTATACTTCTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 17, + strand):


1   gtttaaggtg acacattgca agacgtgggg ggaggggtgg cattgtgcat ttattcttca
61  ttctgaaagt ttctgatggg tccctggctt gggacatggc ctgaatctgt cccctagtga
121 caccgcagag gaagacgagg acctttatga ctgcgtggaa aatgaggagg cagaggggga
181 cgagatctac gaggacctaa tgcgcttgga gtcggtgcct acgccagtga gtgggcctgg
241 gaagggcggg gcaggtggga agggtagaga tggctgcagg gagcttcacc agcctctatg
301 gtctctgctc acagcccaag atgacagagt atgataagcg ctgctgctgc ctgcgggaga
361 tccagcagac ggaggagaag tatacagaca cactgggctc c


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler