Phenotypic Mutation 'eden_express' (pdf version)
List |< first << previous [record 31 of 132] next >> last >|
Alleleeden_express
Mutation Type nonsense
Chromosome14
Coordinate20,528,195 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Ppp3cb
Gene Name protein phosphatase 3, catalytic subunit, beta isoform
Synonym(s) Calnb, PP2BA beta, Cnab, CnAbeta, 1110063J16Rik
Chromosomal Location 20,499,364-20,546,573 bp (-)
MGI Phenotype PHENOTYPE: Homozygous null mice have small hearts and thymi, and reduced body weight. Cardiac function is normal, but mice lack a cardiac hypertrophic response to pressure overload, angiotensin II, or isopreteronol. Thymi are hypoplastic, with abnormal T cell development and reduced numbers of T cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008914 (variant 1), NM_001310426 (variant 2), NM_001310427 (variant 3); MGI:107163

Mapped Yes 
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022355] [ENSMUSP00000125722] [ENSMUSP00000125630] [ENSMUSP00000125582]
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816
AA Change: C162*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 12091710
FACS CD8+ T cells in CD3+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS macrophages - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK cells - increased
FACS T cells - decreased 12091710
OVA-specific IgE - increased
Total IgE After 2nd OVA/Alum Challenge (day 7) - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(28) : Gene trapped(25) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ppp3cb APN 14 20528250 missense probably benign 0.00
IGL00844:Ppp3cb APN 14 20531686 missense possibly damaging 0.95
IGL01859:Ppp3cb APN 14 20509449 missense probably damaging 0.99
IGL02490:Ppp3cb APN 14 20531658 critical splice donor site probably null
IGL02546:Ppp3cb APN 14 20501554 missense probably benign 0.00
IGL02555:Ppp3cb APN 14 20530953 missense probably damaging 1.00
IGL02724:Ppp3cb APN 14 20523577 splice site probably null
IGL02944:Ppp3cb APN 14 20528235 missense probably damaging 1.00
IGL03072:Ppp3cb APN 14 20531725 missense probably damaging 1.00
IGL03301:Ppp3cb APN 14 20523984 missense probably damaging 0.99
Copacabana UTSW 14 20530942 critical splice donor site probably null
everglades UTSW 14 20530948 missense probably damaging 1.00
prokopios UTSW 14 20520652 missense probably benign 0.05
Redwood UTSW 14 20509440 missense probably damaging 1.00
R0026:Ppp3cb UTSW 14 20531768 missense probably benign 0.00
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0050:Ppp3cb UTSW 14 20531752 missense possibly damaging 0.85
R0218:Ppp3cb UTSW 14 20523976 missense probably damaging 0.99
R0479:Ppp3cb UTSW 14 20503241 unclassified probably null
R1013:Ppp3cb UTSW 14 20524004 missense probably benign
R1061:Ppp3cb UTSW 14 20508614 splice site probably null
R1498:Ppp3cb UTSW 14 20509499 critical splice acceptor site probably null
R1508:Ppp3cb UTSW 14 20524424 missense probably damaging 0.99
R1719:Ppp3cb UTSW 14 20524063 missense probably benign 0.05
R1799:Ppp3cb UTSW 14 20524472 missense possibly damaging 0.81
R1883:Ppp3cb UTSW 14 20523845 missense possibly damaging 0.66
R2082:Ppp3cb UTSW 14 20508678 missense possibly damaging 0.66
R2176:Ppp3cb UTSW 14 20520652 missense probably benign 0.05
R3021:Ppp3cb UTSW 14 20523853 nonsense probably null
R3726:Ppp3cb UTSW 14 20530942 critical splice donor site probably null
R4085:Ppp3cb UTSW 14 20508543 missense possibly damaging 0.73
R4328:Ppp3cb UTSW 14 20530948 missense probably damaging 1.00
R4509:Ppp3cb UTSW 14 20515501 intron probably benign
R4600:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4601:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4603:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4610:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4611:Ppp3cb UTSW 14 20520646 missense possibly damaging 0.60
R4694:Ppp3cb UTSW 14 20501515 missense probably benign 0.00
R4749:Ppp3cb UTSW 14 20524062 missense probably damaging 1.00
R4866:Ppp3cb UTSW 14 20523843 missense probably damaging 1.00
R4911:Ppp3cb UTSW 14 20509440 missense probably damaging 1.00
R5105:Ppp3cb UTSW 14 20509422 missense possibly damaging 0.84
R5219:Ppp3cb UTSW 14 20528195 nonsense probably null
R5586:Ppp3cb UTSW 14 20520690 splice site probably benign
R5740:Ppp3cb UTSW 14 20501596 missense possibly damaging 0.76
R6649:Ppp3cb UTSW 14 20531026 missense probably damaging 1.00
Mode of Inheritance Autosomal Semidominant
Local Stock
Repository
Last Updated 2018-09-24 5:27 PM by Diantha La Vine
Record Created 2017-08-28 7:46 AM by Bruce Beutler
Record Posted 2017-09-15
Phenotypic Description

Figure 1. Eden_express mice exhibit B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Eden_express mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Eden_express mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Eden_express mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Eden_express mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Eden_express mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Eden_express mice exhibit increased expression of CD44 on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Eden_express phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5219, some of which exhibited an increase in the B to T cell ratio (Figure 1) as well as reduced frequencies of T cells (Figure 2), CD8+ T cells (Figure 3), and naïve CD8 T cells in CD8 T cells (Figure 4) with concomitant increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 5), all in the peripheral blood. The expression of CD44+ on peripheral blood T cells (Figure 6) and CD8+ T cells (Figure 7) was increased.

Nature of Mutation

Figure 8. Linkage mapping of the increased central memory CD8 T cells in CD8 T cells frequency phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 67 mutations (X-axis) identified in the G1 male of pedigree R5219. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 67 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Ppp3cb: a C to A transversion at base pair 20,528,195 (v38) on chromosome 14, or base pair 18,379 in the GenBank genomic region NC_000080 encoding Ppp3cb. The strongest association was found with a recessive model of inheritance to the normalized frequency of central memory CD8 T cells in CD8 T cells, wherein one variant homozygote departed phenotypically from 17 heterozygotes and 12 homozygous reference mice with a P value of 7.13 x 10-11 (Figure 8). A substantial semidominant effect was observed in most of the assays.

 

The mutation corresponds to residue 619 in the mRNA sequence NM_008914 within exon 4 of 14 total exons.

 

602 AGAGGCAACCATGAATGCAGACACCTTACTGAA

157 -R--G--N--H--E--C--R--H--L--T--E-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 162 for a premature stop codon (C162*) in the encoded protein.

Protein Prediction
Figure 9. Domain structure of CnAβ. The location of the eden_express mutation is indicated. Abbreviations: PP, poly-pro; the CnB-binding domains are indicated by a "1" and "2"; CaM, calmodulin-binding domain; Inh, inhbitory. This image is interactive; click to view other Ppp3cb mutations.

Ppp3cb encodes calcineurin Aβ (CnAβ)a calcineurin catalytic subunit isoform. All of the CnA proteins have a catalytic domain that is highly homologous to other serine/threonine protein phosphatases (amino acids 2-310 in CnAβ) (Figure 9). Within the catalytic domain is a poly-proline motif (amino acids 11-20 in CnAβ) that is specific for the CnAβ catalytic subunit (1). The CnA proteins have three C-terminal regulatory domains that include a CnB binding domain (amino acids 256-262 and 305-310 in CnAβ), a CaM-binding domain (amino acids 401-423 in CnAβ), and an autoinhibitory domain (amino acids 474-496 in CnAβ) (1;2). Ppp3cb can be alternatively spliced upon insulin-like growth factor 1 induction to generate a CnAβ1 isoform (3). The CnAβ1 isoform does not have an autoinhibitory domain, and contains a unique C-terminal domain to CnAβ (4). The Eden_express mutation results in substitution of cysteine 162 for a premature stop codon (C162*). Amino acid 162 is within the catalytic domain.

 

Please see the record Copacabana for more information about Ppp3cb.

Putative Mechanism

Calcineurin (alternatively, PP2B) is a calcium- and calmodulin (CaM)-dependent serine/threonine protein phosphatase that consists of a catalytic subunit and a regulatory calcium-binding subunit, termed calcineurin A (CnA) and calcineurin B (CnB), respectively. Calcineurin has functions in T cell activation, activation-induced cell death (AICD), T cell tolerance, ion channel regulation, cardiac myocyte hypertrophy, sperm motility, synaptic endocytosis, and Alzheimer’s disease (5-8). Upon calcineurin activation, it dephosphorylates members of the nuclear factor of activated T cells (NFAT) family, promoting their translocation from the cytosol to the nucleus and subsequent induction of the transcription of NFAT target genes such as IL-2 growth factor, IFN-γ, and IL-4.  In addition to cytokine production, calcineurin-NFAT signaling mediates T cell maturation, synaptic transmission in neurons, vascular patterning in embryonic development, hypertrophic growth of the heart, and regulation of oxidative/slow fiber content in glycolytic/fast muscles (i.e., gastrocnemius, tibialis anterior, biceps, and triceps) (9;10).

 

CnAβ is required for the spontaneous survival of naïve T cells (11). Naïve T cells from Ppp3cb-deficient (Ppp3cb-/-) mice exhibited increased spontaneous apoptosis that could be blocked by IL-7 and IL-15. Ppp3cb-/- mice exhibit a reduction in CD3T cells in the peripheral blood compared to that in wild-type mice (12). In addition, the frequency of both thymic and splenic CD4and CD8cells in the Ppp3cb-/- mice was reduced compared to that in wild-type mice. The numbers of single positive T cells increased in the Ppp3cb-/- mice with age to levels comparable to wild-type mice (8). Thymus cellularity was also reduced in the Ppp3cb-/- mice. Splenic T cells from Ppp3cb-/- mice exhibited reduced proliferation induced by CD3 cross-linking or PMA/ionomycin. CnAα is able to partially compensate for the function of CnAβ in T cell activation, but both are required for efficient cell activation. After calcineurin-induced activation, NF-AT forms a complex with FOXP3 to induce regulatory T cell (Treg) cell generation through the induction of Il2ra (CD25) and Ctla4 (CD152) (13). Loss of CnAβ expression results in deficient Treg cell generation with a concomitant expansion of mature T cells with an activated phenotype (8). Calcineurin has a several functions including a role in apoptosis of T and B cells (14-16) and neuronal cells (17). In lymphocytes, calcineurin and NF-AT function in apoptosis by mediating the induction of Fas and FasL, which transduce an apoptotic signal upon T cell activation (18;19).

 

The phenotypes observed in the Eden_express mice indicates that CnAβEden_express exhibits loss of function.

Primers PCR Primer
eden_express(F):5'- TTTCAAAAGTATACACTGGTGGTC -3'
eden_express(R):5'- AGGAAAGAAGCCATTTTGTTAGGC -3'

Sequencing Primer
eden_express_seq(F):5'- ATACACTGGTGGTCATGGAATG -3'
eden_express_seq(R):5'- GAAAGTTCACTGGAAACGT -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 31 of 132] next >> last >|