Phenotypic Mutation 'stryker'

• Allele: stryker
• Mutation Type: nonsense
• Chromosome: 2
• Coordinate: 163,925,608 bp (GRCm39)
• Base Change: A ⇒ T (forward strand)
• Gene: Stk4
• Gene Name: serine/threonine kinase 4
• Synonym(s): sterile 20-like kinase 1, Kas-2, Ysk3, Mst1
• Chromosomal Location: 163,916,033-163,997,444 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Lysine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000018353] [ENSMUSP00000122440]
• AlphaFold: Q9JI11
• SMART Domains: Protein: ENSMUSP00000018353; Gene: ENSMUSG00000018209; AA Change: K59*

Domain	Start	End	E-Value	Type
S_TKc	30	281	1.97e-104	SMART
low complexity region	311	326	N/A	INTRINSIC
Pfam:Mst1_SARAH	433	480	2.4e-26	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000122440; Gene: ENSMUSG00000018209; AA Change: K58*

Domain	Start	End	E-Value	Type
Pfam:Pkinase	29	113	7.2e-22	PFAM
Pfam:Pkinase_Tyr	29	113	1.1e-17	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Diantha La Vine
• Record Created: 2017-08-28 8:30 AM by Bruce Beutler
• Record Posted: 2018-08-15
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_021420; MGI:1929004

Alleles Listed at MGI

All Mutations and Alleles(53) : Chemically induced (ENU)(2) Gene trapped(38) Targeted(13)

Phenotypic Description

Figure 1. Stryker mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Stryker mice exhibit increased CD4 to CD8 cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Stryker mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Stryker mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Stryker mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Stryker mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Stryker mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Stryker mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Stryker mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Stryker mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Stryker mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Stryker mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Stryker mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Stryker mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 15. Stryker mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 16. Stryker mice exhibit increased expression of IgD on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 17. Stryker mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 18. Stryker mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 19. Stryker mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The stryker phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5088, some of which showed an increase in the B to T cell ratio (Figure 1) and an increase in the CD4 to CD8 T cell ratio (Figure 2). Some mice showed reduced frequencies T cells (Figure 3), CD4+ T cells (Figure 4), CD8+ T cells (Figure 5), CD8+ T cells in CD3+ T cells (Figure 6), naïve CD4 T cells in CD4 T cells (Figure 7), and naïve CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of central memory CD4 T cells in CD4 T cells (Figure 9), central memory CD8 T cells in CD8 T cells (Figure 10), effector memory CD4 T cells in CD4 T cells (Figure 11), effector memory CD8 T cells in CD8 T cells (Figure 12), macrophages (Figure 13), neutrophils (Figure 14), and natural killer (NK) cells (Figure 15), all in the peripheral blood. The expression of IgD on peripheral blood B cells was reduced (Figure 16) and the expression of CD44 on peripheral blood T cells (Figure 17), CD4 T cells (Figure 18), and CD8 T cells (Figure 19) was increased.

The phenotypes observed in the stryker mice were verified by CRISPR/Cas9-mediated targeting of Stk4.

Nature of Mutation

Figure 20. Linkage mapping of the normalized frequency of effector memory CD8 T cells in CD8 T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 70 mutations (X-axis) identified in the G1 male of pedigree R5088. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations.  All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 2: Ptprt and Stk4. The mutation in Stk4 was presumed causative as other alleles of Stk4 (see hallon) exhibit similar immunological phenotypes as stryker. The mutation in Stk4 is an A to T transversion at base pair 164,083,688 (v38) on chromosome 2, or base pair 9,576 in the GenBank genomic region NC_000068 encoding Stk4.  The strongest association was found with a recessive model of inheritance to the normalized frequency of effector memory CD8 T cells in CD8 T cells, wherein four variant homozygotes departed phenotypically from nine homozygous reference mice and five heterozygous mice with a P value of 1.233 x 10^-19 (Figure 20).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

The mutation corresponds to residue 210 in the mRNA sequence NM_021420 within exon 3 of 11 total exons.

195 CAGATTGTTGCAATCAAGCAAGTGCCCGTGGAA 54  -Q--I--V--A--I--K--Q--V--P--V--E-

The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 58 for a premature stop codon (K59*) in the STK4 protein.

Protein Prediction

Figure 21. Domain organization of MST1. The stryker mutation results in substitution of lysine 58 for a premature stop codon. Other mutations found in the MST1 protein are shown in red. Click on each mutation for more information. Abbreviations: CC, coiled-coil; SARAH, Salvador/Rassf/Hippo domain.

Stk4 encodes mammalian sterile 20-like kinase 1 (MST1; alternatively, serine/threonine protein kinase 4 [STK4]), a member of the MST family of kinases that also includes MST2 (STK3), MST3 (STK24), MST4 (STK26), and YSK1 (STK25) [reviewed in (1)]. MST1 has two domains, an N-terminal kinase domain and a C-terminal SARAH (Salvador/Rassf/Hippo) domain (Figure 21). The SARAH domain is also involved in dimerization (2). In the Salvador and Hippo families, the SARAH domain mediates signal transduction from Hippo via the Salvador scaffolding protein to the downstream component Warts (SMART). The MST1 SARAH domain interacts with the SARAH domains of Rassf1 and Rassf5 (alternatively, Nore1), subsequently promoting apoptosis (2;3).

The stryker mutation results in substitution of lysine 58 for a premature stop codon (K59*) in the STK4 protein; Lys59 is within the kinase domain.

For more information about Stk4, please see the record for hallon.

Putative Mechanism

MST1 is a serine/threonine kinase with both proaopototic and antiapoptotic functions in several systems, including the immune system (4;5), cardiovascular system (6;7), digestive system (8;9), respiratory system (10), and the central nervous system [reviewed in (11)]. MST1 and MST2 are mammalian orthologs of Drosophila Hippo. Hippo is within a pathway that restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasis. Upon Hippo pathway activation, the TAO kinases (TAOK1/2/3 see the record for taoist) phosphorylate Thr183 of MST1 (and Thr180 in MST2), resulting in MST1/2 activation (12). Thr183 can also be autophosphorylated. MST1/2 (in complex with the regulatory scaffold protein SAV1 [alternatively, WW45]) phosphorylate and activate large tumor suppressor 1/2 (LATS1/2). Activated LATS1/2 in complex with the regulatory protein MOB1 subsequently phosphorylates and inactivates the Yes-associated protein-1 (YAP1) oncoprotein (see the record for Puddel_hunde) and transcriptional coactivator with PDZ-binding motif (TAZ). When active, YAP1 and TAZ translocate to the nucleus to bind the TEAD transcription factor family (homologs of Drosophila Scalloped) and induce the expression of its target genes involved in cell proliferation, cell death, and cell migration.

Mutations in STK4 are linked to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations (OMIM: #614868) (13;14). Patients exhibited T- and B-cell lymphopenia, intermittent neutropenia, and atrial septal defects (14). Patients exhibited recurring bacterial infections, viral infections, skin abscesses, cutaneous warts, and mucocutaneous candidiasis.

MST1/2 phosphorylates members of the forkhead box O (FOXO) transcription factor family. The MST1-FOXO signaling pathway also maintains naïve T cell homeostasis and enhances Treg differentiation by promoting Foxp3’s acetylation and activity (15). Stk4-deficient (Stk4^-/-) mice exhibit progressive loss of T and B cells due to excessive apoptosis (16;17). The Stk4^-/- mice have reduced numbers of naïve T cells in secondary lymphoid organs and in the peripheral blood. Stk4^-/- mice exhibited an accumulation of mature thymocytes in the thymus, a reduction of lymphocytes in blood and peripheral lymphoid tissues, and reduced ability to traffic to peripheral lymph nodes (4). Thymocytes from the Stk4^-/- mice showed diminished chemotactic responses to CCL19, but not S1P (4). Mature T cells from the Stk4^-/- mice exhibited a reduced capacity to egress from the thymus. Stk4^-/- naïve T cells exhibited increased proliferation in response to TCR stimulation; the proliferative responses of Stk4^-/- effector/memory T cells was comparable to that in wild-type (17). Stk4^-/- mice exhibited inefficient migration and antigen recognition of CD4+ T cells within the medulla (18).

Mice that lack either Stk3 or Stk4 are viable, but mice that lack both Stk3 and Stk4 (Stk3^-/-; Stk4^-/-) are not (16). The Stk3^-/-; Stk4^-/- mice exhibited growth retardation, failed placental development, impaired yolk sac/embryo vascular patterning and primitive hematopoiesis, increased apoptosis in placentas and embryos, and disorganized proliferating cells in the embryo. A liver-specific double-knockout model exhibits hepatomegaly and hepatocellular carcinoma.

The phenotype observed in the stryker mice indicates loss of MST1^stryker function.

Primers

PCR Primer
stryker_pcr_F: GTGGCCATAGAAAACACACATG
stryker_pcr_R: TTTTCAGAAAGAACATGCCCTGC

Sequencing Primer
stryker_seq_F: ATCGCATTCAGACTGCATGG
stryker_seq_R: GAAAGAACATGCCCTGCGGTTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 408 nucleotides is amplified (chromosome 2, + strand):

1   gtggccatag aaaacacaca tgtgtattgt gttgctgtga agggaaaacg agcatcgcat
61  tcagactgca tggttcagat catggcagca cttccacgag cgtgggtaat tcatgcgatt
121 gtgccacacc tggccttgcc tctcggtgtc ttatgaatga tctccttccc ccaaacgcag
181 gtcttatggc agcgtgtaca aggctattca taaagagact ggccagattg ttgcaatcaa
241 gcaagtgccc gtggaatcgg acctgcagga gataatcaag gaaatctcca tcatgcagca
301 gtgtgacagg taaagcctcg ggtcctctga cagacagagc tcggccagcc tggcgcctac
361 agactggagg gcggggctgg gaaccgcagg gcatgttctt tctgaaaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Thompson, B. J., and Sahai, E. (2015) MST Kinases in Development and Disease. J Cell Biol. 210, 871-882.

  2. Hwang, E., Ryu, K. S., Paakkonen, K., Guntert, P., Cheong, H. K., Lim, D. S., Lee, J. O., Jeon, Y. H., and Cheong, C. (2007) Structural Insight into Dimeric Interaction of the SARAH Domains from Mst1 and RASSF Family Proteins in the Apoptosis Pathway. Proc Natl Acad Sci U S A. 104, 9236-9241.

  3. Scheel, H., and Hofmann, K. (2003) A Novel Interaction Motif, SARAH, Connects Three Classes of Tumor Suppressor. Curr Biol. 13, R899-900.

  4. Dong, Y., Du, X., Ye, J., Han, M., Xu, T., Zhuang, Y., and Tao, W. (2009) A Cell-Intrinsic Role for Mst1 in Regulating Thymocyte Egress. J Immunol. 183, 3865-3872.

  5. Mou, F., Praskova, M., Xia, F., Van Buren, D., Hock, H., Avruch, J., and Zhou, D. (2012) The Mst1 and Mst2 Kinases Control Activation of Rho Family GTPases and Thymic Egress of Mature Thymocytes. J Exp Med. 209, 741-759.

  6. von Gise, A., Lin, Z., Schlegelmilch, K., Honor, L. B., Pan, G. M., Buck, J. N., Ma, Q., Ishiwata, T., Zhou, B., Camargo, F. D., and Pu, W. T. (2012) YAP1, the Nuclear Target of Hippo Signaling, Stimulates Heart Growth through Cardiomyocyte Proliferation but Not Hypertrophy. Proc Natl Acad Sci U S A. 109, 2394-2399.

  7. Yamamoto, S., Yang, G., Zablocki, D., Liu, J., Hong, C., Kim, S. J., Soler, S., Odashima, M., Thaisz, J., Yehia, G., Molina, C. A., Yatani, A., Vatner, D. E., Vatner, S. F., and Sadoshima, J. (2003) Activation of Mst1 Causes Dilated Cardiomyopathy by Stimulating Apoptosis without Compensatory Ventricular Myocyte Hypertrophy. J Clin Invest. 111, 1463-1474.

  8. Lu, L., Li, Y., Kim, S. M., Bossuyt, W., Liu, P., Qiu, Q., Wang, Y., Halder, G., Finegold, M. J., Lee, J. S., and Johnson, R. L. (2010) Hippo Signaling is a Potent in Vivo Growth and Tumor Suppressor Pathway in the Mammalian Liver. Proc Natl Acad Sci U S A. 107, 1437-1442.

  9. Zhou, D., Zhang, Y., Wu, H., Barry, E., Yin, Y., Lawrence, E., Dawson, D., Willis, J. E., Markowitz, S. D., Camargo, F. D., and Avruch, J. (2011) Mst1 and Mst2 Protein Kinases Restrain Intestinal Stem Cell Proliferation and Colonic Tumorigenesis by Inhibition of Yes-Associated Protein (Yap) Overabundance. Proc Natl Acad Sci U S A. 108, E1312-20.

  10. Chung, C., Kim, T., Kim, M., Kim, M., Song, H., Kim, T. S., Seo, E., Lee, S. H., Kim, H., Kim, S. K., Yoo, G., Lee, D. H., Hwang, D. S., Kinashi, T., Kim, J. M., and Lim, D. S. (2013) Hippo-Foxa2 Signaling Pathway Plays a Role in Peripheral Lung Maturation and Surfactant Homeostasis. Proc Natl Acad Sci U S A. 110, 7732-7737.

  11. Chen, S., Fang, Y., Xu, S., Reis, C., and Zhang, J. (2018) Mammalian Sterile20-Like Kinases: Signalings and Roles in Central Nervous System. Aging Dis. 9, 537-552.

  12. Boggiano, J. C., Vanderzalm, P. J., and Fehon, R. G. (2011) Tao-1 Phosphorylates Hippo/MST Kinases to Regulate the Hippo-Salvador-Warts Tumor Suppressor Pathway. Dev Cell. 21, 888-895.

  13. Nehme, N. T., Pachlopnik Schmid, J., Debeurme, F., Andre-Schmutz, I., Lim, A., Nitschke, P., Rieux-Laucat, F., Lutz, P., Picard, C., Mahlaoui, N., Fischer, A., and de Saint Basile, G. (2012) MST1 Mutations in Autosomal Recessive Primary Immunodeficiency Characterized by Defective Naive T-Cell Survival. Blood. 119, 3458-3468.

  14. Abdollahpour, H., Appaswamy, G., Kotlarz, D., Diestelhorst, J., Beier, R., Schaffer, A. A., Gertz, E. M., Schambach, A., Kreipe, H. H., Pfeifer, D., Engelhardt, K. R., Rezaei, N., Grimbacher, B., Lohrmann, S., Sherkat, R., and Klein, C. (2012) The Phenotype of Human STK4 Deficiency. Blood. 119, 3450-3457.

  15. Choi, J., Oh, S., Lee, D., Oh, H. J., Park, J. Y., Lee, S. B., and Lim, D. S. (2009) Mst1-FoxO Signaling Protects Naive T Lymphocytes from Cellular Oxidative Stress in Mice. PLoS One. 4, e8011.

  16. Oh, S., Lee, D., Kim, T., Kim, T. S., Oh, H. J., Hwang, C. Y., Kong, Y. Y., Kwon, K. S., and Lim, D. S. (2009) Crucial Role for Mst1 and Mst2 Kinases in Early Embryonic Development of the Mouse. Mol Cell Biol. 29, 6309-6320.

  17. Zhou, D., Medoff, B. D., Chen, L., Li, L., Zhang, X. F., Praskova, M., Liu, M., Landry, A., Blumberg, R. S., Boussiotis, V. A., Xavier, R., and Avruch, J. (2008) The Nore1B/Mst1 Complex Restrains Antigen Receptor-Induced Proliferation of Naive T Cells. Proc Natl Acad Sci U S A. 105, 20321-20326.

  18. Ueda, Y., Katagiri, K., Tomiyama, T., Yasuda, K., Habiro, K., Katakai, T., Ikehara, S., Matsumoto, M., and Kinashi, T. (2012) Mst1 Regulates Integrin-Dependent Thymocyte Trafficking and Antigen Recognition in the Thymus. Nat Commun. 3, 1098.