Phenotypic Mutation 'stryker' (pdf version)
List |< first << previous [record 37 of 132] next >> last >|
Allelestryker
Mutation Type nonsense
Chromosome2
Coordinate164,083,688 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Stk4
Gene Name serine/threonine kinase 4
Synonym(s) Ysk3, sterile 20-like kinase 1, Kas-2, Mst1
Chromosomal Location 164,070,322-164,155,524 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021420; MGI:1929004

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000018353] [ENSMUSP00000122440]
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209
AA Change: K59*

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000122440
Gene: ENSMUSG00000018209
AA Change: K58*

DomainStartEndE-ValueType
Pfam:Pkinase 29 113 7.2e-22 PFAM
Pfam:Pkinase_Tyr 29 113 1.1e-17 PFAM
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1a cells in B1 cells - decreased
FACS B1b cells - increased
FACS B1b cells in B1 cells - increased
FACS B2 cells - decreased
FACS B220 MFI - decreased
FACS CD4:CD8 - increased
FACS CD4+ T cells - decreased 19073936
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased 19073936
FACS CD8+ T cells in CD3+ T cells - decreased 19073936
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased 19073936
FACS effector memory CD8 T cells in CD8 T cells - increased 19073936
FACS IgD MFI - decreased
FACS macrophages - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK cells - increased
FACS T cells - decreased 19339990
Fasting Insulin (Female) - increased
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Total IgE After 2nd OVA/Alum Challenge (day 7) - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(53) : Chemically induced (ENU)(2) Gene trapped(38) Targeted(13)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
hallon UTSW 2 164099827 critical splice donor site
ribeye UTSW 2 164079566 missense probably damaging 1.00
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1972:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3155:Stk4 UTSW 2 164151743 missense probably benign 0.01
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5088:Stk4 UTSW 2 164083688 nonsense probably null
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-21 1:09 PM by Anne Murray
Record Created 2017-08-28 8:30 AM by Bruce Beutler
Record Posted 2018-08-15
Phenotypic Description

Figure 1. Stryker mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Stryker mice exhibit increased CD4 to CD8 cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Stryker mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Stryker mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Stryker mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Stryker mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Stryker mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Stryker mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Stryker mice exhibit increased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Stryker mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Stryker mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Stryker mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Stryker mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Stryker mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Stryker mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Stryker mice exhibit increased expression of IgD on peripheral blood B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Stryker mice exhibit increased expression of CD44 on peripheral blood T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Stryker mice exhibit increased expression of CD44 on peripheral blood CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 19. Stryker mice exhibit increased expression of CD44 on peripheral blood CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The stryker phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5088, some of which showed an increase in the B to T cell ratio (Figure 1) and an increase in the CD4 to CD8 T cell ratio (Figure 2). Some mice showed reduced frequencies T cells (Figure 3), CD4+ T cells (Figure 4), CD8+ T cells (Figure 5), CD8+ T cells in CD3+ T cells (Figure 6), naïve CD4 T cells in CD4 T cells (Figure 7), and naïve CD8 T cells in CD8 T cells (Figure 8) with concomitant increased frequencies of central memory CD4 T cells in CD4 T cells (Figure 9), central memory CD8 T cells in CD8 T cells (Figure 10), effector memory CD4 T cells in CD4 T cells (Figure 11), effector memory CD8 T cells in CD8 T cells (Figure 12), macrophages (Figure 13), neutrophils (Figure 14), and natural killer (NK) cells (Figure 15), all in the peripheral blood. The expression of IgD on peripheral blood B cells was reduced (Figure 16) and the expression of CD44 on peripheral blood T cells (Figure 17), CD4 T cells (Figure 18), and CD8 T cells (Figure 19) was increased.

 

The phenotypes observed in the stryker mice were verified by CRISPR/Cas9-mediated targeting of Stk4.

Nature of Mutation

Figure 20. Linkage mapping of the normalized frequency of effector memory CD8 T cells in CD8 T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 70 mutations (X-axis) identified in the G1 male of pedigree R5088. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 70 mutations.  All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 2: Ptprt and Stk4. The mutation in Stk4 was presumed causative as other alleles of Stk4 (see hallon) exhibit similar immunological phenotypes as stryker. The mutation in Stk4 is an A to T transversion at base pair 164,083,688 (v38) on chromosome 2, or base pair 9,576 in the GenBank genomic region NC_000068 encoding Stk4.  The strongest association was found with a recessive model of inheritance to the normalized frequency of effector memory CD8 T cells in CD8 T cells, wherein four variant homozygotes departed phenotypically from nine homozygous reference mice and five heterozygous mice with a P value of 1.233 x 10-19 (Figure 20).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 210 in the mRNA sequence NM_021420 within exon 3 of 11 total exons.


 

195 CAGATTGTTGCAATCAAGCAAGTGCCCGTGGAA

54  -Q--I--V--A--I--K--Q--V--P--V--E-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 58 for a premature stop codon (K59*) in the STK4 protein.

Protein Prediction
Figure 21. Domain organization of MST1. The stryker mutation results in substitution of lysine 58 for a premature stop codon. Other mutations found in the MST1 protein are shown in red. Click on each mutation for more information. Abbreviations: CC, coiled-coil; SARAH, Salvador/Rassf/Hippo domain.

Stk4 encodes mammalian sterile 20-like kinase 1 (MST1; alternatively, serine/threonine protein kinase 4 [STK4]), a member of the MST family of kinases that also includes MST2 (STK3), MST3 (STK24), MST4 (STK26), and YSK1 (STK25) [reviewed in (1)]. MST1 has two domains, an N-terminal kinase domain and a C-terminal SARAH (Salvador/Rassf/Hippo) domain (Figure 21). The SARAH domain is also involved in dimerization (2). In the Salvador and Hippo families, the SARAH domain mediates signal transduction from Hippo via the Salvador scaffolding protein to the downstream component Warts (SMART). The MST1 SARAH domain interacts with the SARAH domains of Rassf1 and Rassf5 (alternatively, Nore1), subsequently promoting apoptosis (2;3).

 

The stryker mutation results in substitution of lysine 58 for a premature stop codon (K59*) in the STK4 protein; Lys59 is within the kinase domain.

 

For more information about Stk4, please see the record for hallon.

Putative Mechanism

MST1 is a serine/threonine kinase with both proaopototic and antiapoptotic functions in several systems, including the immune system (4;5), cardiovascular system (6;7), digestive system (8;9), respiratory system (10), and the central nervous system [reviewed in (11)]. MST1 and MST2 are mammalian orthologs of Drosophila Hippo. Hippo is within a pathway that restricts cell proliferation and promotes apoptosis during development, growth, repair, and homeostasisUpon Hippo pathway activation, the TAO kinases (TAOK1/2/3 see the record for taoist) phosphorylate Thr183 of MST1 (and Thr180 in MST2), resulting in MST1/2 activation (12). Thr183 can also be autophosphorylated. MST1/2 (in complex with the regulatory scaffold protein SAV1 [alternatively, WW45]) phosphorylate and activate large tumor suppressor 1/2 (LATS1/2). Activated LATS1/2 in complex with the regulatory protein MOB1 subsequently phosphorylates and inactivates the Yes-associated protein-1 (YAP1) oncoprotein (see the record for Puddel_hunde) and transcriptional coactivator with PDZ-binding motif (TAZ). When active, YAP1 and TAZ translocate to the nucleus to bind the TEAD transcription factor family (homologs of Drosophila Scalloped) and induce the expression of its target genes involved in cell proliferation, cell death, and cell migration.

 

Mutations in STK4 are linked to T-cell immunodeficiency, recurrent infections, autoimmunity, and cardiac malformations (OMIM: #614868) (13;14). Patients exhibited T- and B-cell lymphopenia, intermittent neutropenia, and atrial septal defects (14). Patients exhibited recurring bacterial infections, viral infections, skin abscesses, cutaneous warts, and mucocutaneous candidiasis.

 

MST1/2 phosphorylates members of the forkhead box O (FOXO) transcription factor family. The MST1-FOXO signaling pathway also maintains naïve T cell homeostasis and enhances Treg differentiation by promoting Foxp3’s acetylation and activity (15). Stk4-deficient (Stk4-/-) mice exhibit progressive loss of T and B cells due to excessive apoptosis (16;17). The Stk4-/- mice have reduced numbers of naïve T cells in secondary lymphoid organs and in the peripheral blood. Stk4-/- mice exhibited an accumulation of mature thymocytes in the thymus, a reduction of lymphocytes in blood and peripheral lymphoid tissues, and reduced ability to traffic to peripheral lymph nodes (4). Thymocytes from the Stk4-/- mice showed diminished chemotactic responses to CCL19, but not S1P (4). Mature T cells from the Stk4-/- mice exhibited a reduced capacity to egress from the thymus. Stk4-/- naïve T cells exhibited increased proliferation in response to TCR stimulation; the proliferative responses of Stk4-/- effector/memory T cells was comparable to that in wild-type (17). Stk4-/- mice exhibited inefficient migration and antigen recognition of CD4+ T cells within the medulla (18).

 

Mice that lack either Stk3 or Stk4 are viable, but mice that lack both Stk3 and Stk4 (Stk3-/-; Stk4-/-) are not (16). The Stk3-/-; Stk4-/- mice exhibited growth retardation, failed placental development, impaired yolk sac/embryo vascular patterning and primitive hematopoiesis, increased apoptosis in placentas and embryos, and disorganized proliferating cells in the embryo. A liver-specific double-knockout model exhibits hepatomegaly and hepatocellular carcinoma.

 

The phenotype observed in the stryker mice indicates loss of MST1stryker function.

Primers PCR Primer
stryker(F):5'- GTGGCCATAGAAAACACACATG -3'
stryker(R):5'- TTTTCAGAAAGAACATGCCCTGC -3'

Sequencing Primer
stryker_seq(F):5'- ATCGCATTCAGACTGCATGG -3'
stryker_seq(R):5'- GAAAGAACATGCCCTGCGGTTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 37 of 132] next >> last >|