Phenotypic Mutation 'sailing' (pdf version)
Allelesailing
Mutation Type missense
Chromosome1
Coordinate87,705,964 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Inpp5d
Gene Name inositol polyphosphate-5-phosphatase D
Synonym(s) s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
Chromosomal Location 87,620,312-87,720,507 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010566NM_001110192NM_001110193; MGI: 107357

Mapped Yes 
Amino Acid Change Histidine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000044647] [ENSMUSP00000072763] [ENSMUSP00000126569] [ENSMUSP00000131244] [ENSMUSP00000127941] [ENSMUSP00000132384]
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: H703R

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000042275)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: H703R

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000072999)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: H441R

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000167032)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: H704R

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000168783)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: H704R

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000169754)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: H441R

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000170300)
Meta Mutation Damage Score 0.9565 question?
Is this an essential gene? Probably essential (E-score: 0.887) question?
Phenotypic Category
Phenotypequestion? Literature verified References
125-03 Response - increased
FACS IgM MFI - decreased
FACS NK cells - decreased
LPS-induced Necroptosis - decreased
Macrophage necroptosis: low
TLR signaling defect: hypersensitivity to PAM3CSK4
TLR signaling defect: TNF production by macrophages
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.941; ML prob: 0.91; human score: 4.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(62) : Targeted(7) Gene trapped(53) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
Apfelsine UTSW 1 87683845 nonsense probably null
Auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
Salamander UTSW 1 87695380 missense probably damaging 0.99
Sandstone UTSW 1 87695400 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
tangerine UTSW 1 87705949 missense probably damaging 1.00
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 splice site probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87665399 missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
R7920:Inpp5d UTSW 1 87705949 missense probably damaging 1.00
Z1176:Inpp5d UTSW 1 87669709 missense probably benign 0.16
Z1176:Inpp5d UTSW 1 87703131 missense probably damaging 1.00
Z1191:Inpp5d UTSW 1 87683770 missense probably benign 0.00
Mode of Inheritance Autosomal Dominant
Local Stock
Repository
Last Updated 2020-06-05 4:43 PM by Thomas Gallagher
Record Created 2017-08-28 11:11 AM by Bruce Beutler
Record Posted 2017-10-20
Phenotypic Description
Figure 1. Sailing mice exhibit decreased expression of IgM on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Sailing mice exhibit decreased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Sailing phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5086, some of which showed a decrease in IgM expression on B cells (Figure 1) and reduced frequencies of natural killer cells (Figure 2).

Nature of Mutation

See entry for Inpp5d allele Salamander 

Figure 3. Linkage mapping of the reduced NK cell frequency phenotype using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 76 mutations (X-axis) identified in the G1 male of pedigree R5086. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 76 mutations. Both of the above phenotypes were linked by continuous variable mapping to a mutation in Inpp5d: an A to G transition at base pair 87,705,964 (v38) on chromosome 1, or base pair or 85,653 in the GenBank genomic region, NC_000067 encoding Inpp5d. The strongest association was found with an additive/dominant model of inheritance to the NK cell frequency phenotype, wherein 18 heterozygous mice departed phenotypically from 18 homozygous reference mice with a P value of 5.012 x 10-5 (Figure 3). No homozygous variant mice were found in pedigree R5086. The Inpp5d mutation was presumed causative as the immune phenotypes in the Sailing mice mimicked those found in mice expressing other Inpp5d alleles (see styx).

 

The mutation corresponds to residue 2,288 in the mRNA sequence NM_010566 within exon 19 of 27 total exons.


 

2272 ATCATGACGAGTGACCACAGCCCTGTCTTTGCC

698  -I--M--T--S--D--H--S--P--V--F--A-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of histidine 704 for an arginine (H704R) in the SHIP-1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Domain structure of SHIP protein isoforms. SHIPβ and SHIPδ arise from alternative splicing that occurs adjacent to the first NPXY motif. SHIPβ arises from in-frame splicing, while SHIPδ arises from out-of-frame splicing that results in an alternative C-terminal domain. The sSHIP isoform has an alternative promoter. The SH2 containing isoforms have been shown to be expressed in differentiated hematopoietic cells, mouse embyronic fibroblasts (MEF) and vascular endothelial cells. The sSHIP isoform is expressed by embryonic stem (ES) cells and HSC. Full-length SHIP is also expressed in HSC. Other potential isoforms have been described (not shown). The sailing mutation results in substitution of histidine 704 for an arginine (H704R) in the SHIP-1 protein; it is indicated with a red asterisk. The pink box indicates the portion of the SHIP-1 protein encoded by exon 12. The image is interactive. Other Inpp5d mutations are noted in red. Click on each allele for more information.

Inpp5d encodes SHIP-1, an 1191-amino acid Src homology 2 (SH2) domain-containing inositol polyphosphate 5-phosphatase (Figure 4). The SHIP-1 (hereafter SHIP) protein contains an N-terminal SH2 domain (residues 8-100), two centrally located inositol polyphosphate 5-phosphatase motifs (residues 585-596 and 667-694), two NPXY motifs that, if phosphorylated, could be bound by phosphotyrosine-binding (PTB) domains (residues 913-917 and 1016-1020), and a C-terminal proline-rich domain with several SH3 binding motifs. The Sailing mutation results in substitution of histidine 704 for an arginine (H704R) in the SHIP-1 protein; amino acid 704 is within an undefined region of SHIP-1 following the inositol polyphosphate 5-phosphatase motifs. The Sailing mutation would affect all of the SHIP-1 isoforms.

 

Please see the record styx Salamander for information about Inpp5d.

Putative Mechanism

In hematolymphoid cells, SHIP can be recruited to a wide variety of receptor complexes including growth factor receptors and immune receptors. SHIP is recruited to receptor-associated signaling complexes via adaptors (e.g. Shc, Grb2, Dok3), scaffold proteins like Gab1 or directly via its SH2 domain. After recruitment to the plasma membrane, SHIP can then hydrolyze PIP3. Hydrolysis of PIPinhibits recruitment of PH domain containing kinases like Akt, Btk (Bruton’s tyrosine kinase), and phospholipase C (PLC)-γ to the plasma membrane and thus limits the activity of several different PI3K effectors that promote cell survival, migration, differentiation or proliferation. These include distal kinases like MAP/ERK, JNK/SAPK, p38 MAPK and key transcription factors such as NF-κB and NFAT.

 

Inpp5d knockout mice [MGI:2386884(1;2)] and myeloid-specific conditional knockout mice [MGI:3715983(3)] exhibit reduced levels of B cells. The changes in B cell number was attributed to high levels of the cytokine interleukin-6 (IL-6), which directly contributes to the reduced level of B cells seen in these mice as IL-6 is known to inhibit B cell development while enhancing myeloid cell development (1). In addition to the expansion of other myeloid cell types, SHIP-deficient animals carry large numbers of myeloid suppressor cells that are potent antagonists of allogeneic T cell activation by host APCs in vitro (4). In addition, SHIP-deficient T cells do not produce a type 2 T helper (Th2) response, which is important in determining B cell antibody class switching, when exposed to the proper stimuli (5). An ENU-induced model with a mutation in Inpp5d [Iso651Thr; MGI:5050823(6)] exhibited decreased levels of double-positive thymocytes and a reduced number of circulating lymphocytes. This study determined that a SHIP1 isoform expressed in stem and progenitor cells (s-SHIP), and lost upon the ENU-induced mutation, is necessary for SHIP1 function in hematopoiesis (6).

 

The phenotypes observed in the Sailing mice indicate that SHIP-1Sailing exhibits loss of function.

Primers PCR Primer
sailing_pcr_F: GGCAAGTTCAGGCACCTTTG
sailing_pcr_R: GTGATGTGGCCTGAACATGAAG

Sequencing Primer
sailing_seq_F: ACCTTTGCTTCTTGGACTCAGGG
sailing_seq_R: TGTGGCCTGAACATGAAGAGATC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 402 nucleotides is amplified (chromosome 1, + strand):

 

 

1   ggcaagttca ggcacctttg cttcttggac tcagggtccc cagactaggt ctcagcttgt
61  ccctacagtg agtttgtcat ccacaccttg gtcaaaaggt ctcctctatc cctacttaga
121 aatgccttct ctcccttgca ggcagtacca gtgacatcat gacgagtgac cacagccctg
181 tctttgccac gtttgaagca ggagtcacat ctcaattcgt ctccaagaat ggtaagcaat
241 gggcaacgtc agcttttctt gttttcctca aagacaaggg gcctagggca tttgtcatct
301 ggttgcagct accaattgtc tgggttagat gtaggcctat cctttccttc ccaaggccca
361 tggtctgccc tacctgatct cttcatgttc aggccacatc ac

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler