Phenotypic Mutation 'concur' (pdf version)
Alleleconcur
Mutation Type splice site
Chromosome2
Coordinate121,100,800 bp (GRCm39)
Base Change A ⇒ T (forward strand)
Gene Trp53bp1
Gene Name transformation related protein 53 binding protein 1
Synonym(s) 53BP1, p53BP1
Chromosomal Location 121,023,762-121,101,888 bp (-) (GRCm39)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013735NM_001290830; MGI:1351320

MappedYes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000106277 ] [ENSMUSP00000106278 ] [ENSMUSP00000114457 ]   † probably from a misspliced transcript
AlphaFold P70399
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.9755 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(33) : Chemically induced (ENU)(2) Chemically induced (other)(1) Gene trapped(26) Radiation induced(1) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121087060 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121066476 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121038963 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121100800 splice site probably null
IGL01639:Trp53bp1 APN 2 121033173 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121066506 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121041785 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121046377 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121067070 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121029555 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121033191 missense possibly damaging 0.67
chives UTSW 2 121082349 missense probably null 0.13
confirmation UTSW 2 121035594 critical splice acceptor site probably null
Infra UTSW 2 121077980 critical splice donor site probably null
Legume UTSW 2 121029523 missense probably damaging 0.99
lentil UTSW 2 121082349 missense probably null 0.13
lentil2 UTSW 2 121038368 missense probably damaging 1.00
Profundus UTSW 2 121038284 missense probably damaging 1.00
split_pea UTSW 2 121059087 nonsense probably null
verily UTSW 2 121041794 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121101756 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121034978 missense probably benign
R0060:Trp53bp1 UTSW 2 121035006 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121035006 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121067240 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121067240 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121100718 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121035424 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121066498 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121100450 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121082349 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121082349 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121082349 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121082349 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121058282 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121058653 splice site probably benign
R0593:Trp53bp1 UTSW 2 121101009 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121066188 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121082349 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121078745 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121034799 splice site probably benign
R1377:Trp53bp1 UTSW 2 121101123 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121066665 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121082481 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121035517 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121034964 missense probably benign
R2143:Trp53bp1 UTSW 2 121046545 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121100754 nonsense probably null
R2296:Trp53bp1 UTSW 2 121039728 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121067133 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121030810 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121030810 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121059107 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121035566 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121087131 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121038432 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121038368 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121041794 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121058290 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121038360 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121059087 nonsense probably null
R4850:Trp53bp1 UTSW 2 121035594 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121087122 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121033084 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121051701 nonsense probably null
R4962:Trp53bp1 UTSW 2 121101027 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121100800 splice site probably null
R5111:Trp53bp1 UTSW 2 121041868 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121046598 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121074464 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121038227 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121067143 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121074395 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121038873 nonsense probably null
R5886:Trp53bp1 UTSW 2 121035502 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121067304 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121087083 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121100426 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121101093 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121059084 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121077980 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121038284 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121101057 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121039790 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121059147 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121029594 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121038521 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121029516 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121066950 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121041781 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121066827 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121067119 missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121078295 splice site probably null
R7728:Trp53bp1 UTSW 2 121038380 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121035542 missense probably damaging 0.99
R7955:Trp53bp1 UTSW 2 121066225 missense possibly damaging 0.59
R8099:Trp53bp1 UTSW 2 121030230 missense probably damaging 1.00
R8200:Trp53bp1 UTSW 2 121066657 missense probably benign 0.00
R8282:Trp53bp1 UTSW 2 121029523 missense probably damaging 0.99
R9136:Trp53bp1 UTSW 2 121067092 missense possibly damaging 0.84
R9152:Trp53bp1 UTSW 2 121029056 missense probably damaging 0.99
R9292:Trp53bp1 UTSW 2 121046177 missense probably damaging 0.97
R9340:Trp53bp1 UTSW 2 121100460 missense probably benign 0.40
R9475:Trp53bp1 UTSW 2 121039761 missense probably benign 0.00
R9616:Trp53bp1 UTSW 2 121066657 missense probably benign 0.30
R9675:Trp53bp1 UTSW 2 121087089 missense probably benign 0.03
R9779:Trp53bp1 UTSW 2 121066469 missense probably damaging 1.00
RF046:Trp53bp1 UTSW 2 121046482 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121084126 missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121074541 missense probably benign 0.33
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-09-04 9:39 PM by Diantha La Vine
Record Created 2017-08-28 11:42 AM by Bruce Beutler
Record Posted 2017-09-15
Phenotypic Description

Figure 1. Concur mice exhibit decreased expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The concur phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5019, some of which showed a decrease in IgD expression on B cells (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced IgD expression phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 32 mutations (X-axis) identified in the G1 male of pedigree R5019. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 32 mutations. The IgD phenotype was linked by continuous variable mapping to mutations in two genes on chromosome 2: Trp53bp1. The mutation in Trp53bp1 was presumed causative as the phenotype of the concur mice mimics that of other Trp53bp1 alleles (see lentil), and is a T to A transversion at base pair 121,270,319 (v38) on chromosome 2, or base pair 20,007 in the GenBank genomic region NC_000068 within intron 2 (10 base pairs from exon 3). Linkage was found with a recessive model of inheritance, wherein three variant homozygotes departed phenotypically from 17 homozygous reference mice and 16 heterozygous mice with a P value of 0.000775 (Figure 2).  

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic site in intron 2. The resulting transcript would have a 60-base pair insertion of intron 2, which would cause an in-frame insertion of 19 aberrant amino acids beginning after amino acid 64.

 
C57BL/6J:

                     <--exon 2            <--intron 2 exon 3-->         <--exon 28

19791 ……AACCCCGTGTTG ……atgtgctcatgttttctag GATATTGTATCA…… ……GTTTCTCACTAA…… 91906
61    ……-N--P--V--L-                       -D--I--V--S-…… ……-V--S--H--*-   1969
 

The acceptor splice site of intron 2 is indicated in blue lettering and the mutated nucleotide is indicated in red.  

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Domain structure of 53BP1. The location of the concur mutation is indicated. This image is interactive. Click on each allele for more information. See the text for more details on the domains of 53BP1. Abbreviations: KBD, kinetochore-binding domain; OLIGO, oligomerization domain; GAR, glycine/arginine-rich region; UDR, ubiquitin-dependent recruitment motif; NLS, nuclear localization signal; BRCT, BRCA1 C-terminus. The phosphoinositide 3-kinase-like kinase (PIKK) S/TQ phosphorylation sites are labeled (Ser6, Ser25, Ser29, Ser166, Ser176/Ser178, Thr302, Ser452, Ser831, and Ser1219) as well as the site of ubiquitination (Lys1523).

Trp53bp1 (transformation related protein 53 binding protein 1) encodes 53BP1. 53BP1 has two tandem Tudor domains at amino acids 1475-1575 (1) (alternatively, amino acids 1469-1574 (2) or amino acids 1480-1601, SMART) [Figure 3(3;4)]. Amino acids 1220-1601 of 53BP1 comprise a kinetochore-binding domain (KBD) (1;5). A nuclear localization signal (NLS; amino acids 1645-1703) and the KBD are sufficient to target 53BP1 to IR-induced foci (IRIF) (2). Within the KBD, amino acids 1231–1270 are required for homo-oligomerization (6). 53BP1 has two tandem breast cancer 1 early-onset (BRCA1) C-terminus (BRCT) domains at amino acids 1708-1969 (alternatively, amino acids 1723-1951, SMART(7). 53BP1 has a highly conserved glycine/arginine-rich region (GAR; RGRGRRGR; amino acids 1380-1386) (1;2). The concur mutation is predicted to cause an in-frame insertion of 19 aberrant amino acids beginning after amino acid 64. The affected region is within an undefined region of the 53BP1 protein.

For more information about Trp53bp1, please see the record for lentil and (8).

Putative Mechanism

53BP1 has several functions including facilitating DNA damage signaling, telomere fusions, NHEJ of DNA double strand break (DSBs) in CSR, transducing ATM-dependent cell cycle checkpoints (intra-S and G2/M), accumulation of p53, phosphorylation of several ATM substrates (e.g., Chk2 and BRCA1) in response to IR, and tumor suppression (9-16).

Dysregulation of TRP53BP1 expression is associated with several human conditions. TRP53BP1 expression in BRCA1-associated breast cancers (17;18), lymphomas, and solid tumors is reduced (17;19-21). Low levels of TRP53BP1 are correlated with an aggressive form of the disease, correlating with increased metastases and decreased survival [reviewed in (22)]. 53BP1 deficiency and the deregulation of AID, leads to increased DSB formation, resulting in B cell lymphoma (23). Patients with RIDDLE syndrome (OMIM: #611943) lack the ability to recruit 53BP1 to the sites of DNA DSBs (24).

MEFs from both Trp53bp1-/- and m53BP1tr/tr embryos exhibited reduced proliferation compared to controls (25). Both models are viable, but exhibit growth retardation and increased cellular sensitivity to IR (25;26). The m53BP1tr/tr mice were fertile, but produced smaller litters than wild-type animals (26). After IR, Trp53bp1-/- cells arrested in G2 and exhibited a delayed exit from the G2/M phase; the percentage of mitotic cells 24 hours after IR was lower than wild-type cells (25). The Trp53bp1 mouse models exhibit immune deficiencies including defects in T cell maturation (25;26). The levels of CD4 T cells, γ–δ T cells, and B cells were all reduced in the Trp53bp1-/- mice with a concomitant increase in the percentage of CD4-CD8progenitors and apoptosis (25;27). In addition, the Trp53bp1-/- thymocytes exhibited an increased number of aberrant cells (either lost Cα (2 TCRVα, 1 TCRCα signal) or both Vα and Cα from one allele (1 TCRVα, 1 TCRCα)) (27). Bone marrow pro-B, pre-B, myeloid, and erthyroid progenitor populations were normal in the m53BP1tr/tr mice (16;26). However, the spleens from the m53BP1tr/tr mice were deficient in mature B cells (IgMloIgDhi(26). IgM levels in the Trp53bp1-/- mice were similar to those in wild-type mice, indicating that B cell activation to mediate IgM secretion is not affected upon loss of 53BP1, however, the levels of all IgG subclasses and IgA were decreased (16). CD4 and CD8 T cell populations were similar between m53BP1tr/tr and wild-type mice, but the progression out of the DNIII stage in development, when β-gene rearrangement occurs, was impaired in the m53BP1tr/tr mice (26). Thymus size in the m53BP1tr/tr mice was smaller and had fewer cells than wild-type mice; the lymphoid organ architecture was normal (26).  The phenotype exhibited by the concur mice indicate loss of 53BP1concur function.

Primers PCR Primer
concur_pcr_F: GGCTTCCTTACACATAATCTCAACTG
concur_pcr_R: AAGAGAACCCCGTGTTGGTG

Sequencing Primer
concur_seq_F: CAACTGCATGTTTAAATCGTTCTGC
concur_seq_R: AGTGATGATGCCCTGTTCAAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 416 nucleotides is amplified (chromosome 2, - strand):


1   aagagaaccc cgtgttggtg agtgagtgat gatgccctgt tcaagttatt atttttttct
61  gaccccccta caccaaacta acccagaaaa ttaacgtgtt tagttgattg ttagcttttg
121 gataaagttg gtggggaacg aaaaatgaaa tcaacgtgtt ctcacccaca gaaaggtccc
181 tgttgtacta ctttgtgtac tgtgaggatc ttatgtgctc atgttttcta ggatattgta
241 tcaaatccgg aacaatctgc tgtagaacaa ggagacagta atagctcatt caatgaacat
301 ctgaaagaaa agaaagcttc aggtgagcag ttgaaggctt ggctctctgc agtgtttaag
361 gtcctgtggg ggcagaacga tttaaacatg cagttgagat tatgtgtaag gaagcc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsJin Huk Choi, Xue Zhong, and Bruce Beutler