Phenotypic Mutation 'grouper' (pdf version)
List |< first << previous [record 23 of 132] next >> last >|
Allelegrouper
Mutation Type nonsense
Chromosome2
Coordinate117,302,004 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Rasgrp1
Gene Name RAS guanyl releasing protein 1
Chromosomal Location 117,279,993-117,343,001 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011246; MGI:1314635

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000099593] [ENSMUSP00000133449] [ENSMUSP00000134592] [ENSMUSP00000134027] [ENSMUSP00000134167] [ENSMUSP00000136423]
SMART Domains Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: K116*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
Pfam:EF-hand_6 474 502 5e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347
AA Change: K116*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.2e-5 PFAM
C1 507 556 5.77e-16 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347
AA Change: K116*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_6 442 467 1.1e-5 PFAM
Pfam:C1_1 507 539 3.4e-8 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: K116*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 441 464 1.6e-5 PFAM
Pfam:EF-hand_6 442 467 1.6e-5 PFAM
C1 507 556 5.77e-16 SMART
PDB:4L9U|B 705 756 2e-23 PDB
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347
AA Change: K116*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: K116*

DomainStartEndE-ValueType
RasGEFN 52 176 1.65e-33 SMART
RasGEF 201 437 1.64e-96 SMART
Pfam:EF-hand_5 474 499 3.2e-6 PFAM
C1 542 591 5.77e-16 SMART
PDB:4L9U|B 740 791 2e-23 PDB
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS CD4+ T cells in CD3+ T cells - decreased 22719950
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD8+ T cells in CD3+ T cells - increased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased 22719950
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS NK cells - increased
IgA response to 2nd OVA/Alum Challenge (day 7) - increased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
total IgE level - increased 22719950
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (ENU)(2) Chemically induced (other)(1) Radiation induced(1) Spontaneous(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Rasgrp1 APN 2 117305791 nonsense probably null
IGL00901:Rasgrp1 APN 2 117285130 missense probably damaging 0.96
IGL01083:Rasgrp1 APN 2 117285068 missense probably benign 0.22
IGL01325:Rasgrp1 APN 2 117298529 missense probably damaging 1.00
IGL01520:Rasgrp1 APN 2 117288663 missense probably damaging 1.00
IGL01776:Rasgrp1 APN 2 117286840 critical splice donor site probably null
IGL01780:Rasgrp1 APN 2 117284878 missense probably benign 0.00
IGL01859:Rasgrp1 APN 2 117289418 missense probably benign 0.00
IGL01892:Rasgrp1 APN 2 117293842 missense probably damaging 1.00
IGL02068:Rasgrp1 APN 2 117300578 splice site probably benign
IGL02684:Rasgrp1 APN 2 117282576 missense probably benign 0.03
Haddock UTSW 2 117291895 missense
naejangsan UTSW 2 117291792 nonsense
venutian UTSW 2 117284929 nonsense
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0067:Rasgrp1 UTSW 2 117294820 missense probably damaging 1.00
R0538:Rasgrp1 UTSW 2 117284947 missense probably benign 0.42
R0786:Rasgrp1 UTSW 2 117300499 missense probably benign
R1068:Rasgrp1 UTSW 2 117282576 missense probably benign 0.03
R1165:Rasgrp1 UTSW 2 117284939 missense possibly damaging 0.49
R1491:Rasgrp1 UTSW 2 117282619 nonsense probably null
R1707:Rasgrp1 UTSW 2 117298547 missense probably damaging 1.00
R1869:Rasgrp1 UTSW 2 117290347 missense probably damaging 1.00
R2214:Rasgrp1 UTSW 2 117285165 missense probably damaging 0.98
R2425:Rasgrp1 UTSW 2 117289450 critical splice acceptor site probably null
R3236:Rasgrp1 UTSW 2 117291812 missense probably benign 0.00
R3915:Rasgrp1 UTSW 2 117288641 missense probably damaging 1.00
R4079:Rasgrp1 UTSW 2 117285029 missense probably benign 0.19
R4163:Rasgrp1 UTSW 2 117282654 missense probably benign 0.02
R4781:Rasgrp1 UTSW 2 117291709 missense probably benign 0.04
R4782:Rasgrp1 UTSW 2 117284875 missense probably benign 0.00
R5028:Rasgrp1 UTSW 2 117302004 nonsense probably null
R6019:Rasgrp1 UTSW 2 117291895 missense probably damaging 0.99
R6220:Rasgrp1 UTSW 2 117284929 nonsense probably null
R6294:Rasgrp1 UTSW 2 117291792 nonsense probably null
R6335:Rasgrp1 UTSW 2 117293870 missense probably damaging 0.99
R6948:Rasgrp1 UTSW 2 117298604 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-10-12 4:55 PM by Diantha La Vine
Record Created 2017-08-28 11:58 AM by Bruce Beutler
Record Posted 2018-07-19
Phenotypic Description
Figure 1. Grouper mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Grouper mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Grouper mice exhibit decreased frequencies of peripheral naive CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Grouper mice exhibit decreased frequencies of peripheral naive CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Grouper mice exhibit increased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Grouper mice exhibit increased frequencies of peripheral effector memory CD4+ T cells in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Grouper mice exhibit increased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Grouper mice exhibited increased IgA responses to challenge with ovalbumin administered with aluminum hydroxide (OVA/Alum). IgA levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Grouper mice exhibited increased total IgE levels in the serum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Homozygous grouper mice exhibit diminished T-dependent IgG responses to OVA/Alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Homozygous grouper mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Homozygous grouper mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The grouper phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5028, some of which showed increased B to T cell ratios (Figure 1), reduced frequencies of CD4+ T cells in CD3+ T cells (Figure 2), naive CD4 T cells in CD4 T cells (Figure 3), and naive CD8 T cells in CD8 T cells (Figure 4) with concomitant increased frequencies of CD8+ T cells in CD3+ T cells (Figure 5), effector memory CD4 T cells in CD4 T cells (Figure 6), and natural killer cells (Figure 7), all in the peripheral blood. Some mice exhibited an increased IgA response to challenge with ovalbumin administered with aluminum hydroxide (OVA/Alum) (Figure 8) as well as increased total IgE levels in the serum (Figure 9). The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 10) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 11) were also diminished. The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was reduced (Figure 12). 

Nature of Mutation

Figure 13. Linkage mapping of the IgE phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R5028. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 2: Ttn and Rasgrp1. The Rasgrp1 was presumed causative as the immunological phenotypes observed in the grouper mice mimic those found in other Rasgrp1 alleles (see MGI; accessed September 20, 2017). The mutation in Rasgrp1 is an A to T transversion at base pair 117,302,004 (v38) on chromosome 2, or base pair 40,874 in the GenBank genomic region NC_000068 encoding Rasgrp1. The strongest association was found with a recessive model of inheritance to the normalized amount of IgE, wherein one variant homozygote departed phenotypically from 10 homozygous reference mice and 13 heterozygous mice with a P value of 7.314 x 10-9 (Figure 13).  

 

The mutation corresponds to residue 514 in the mRNA sequence NM_011246 within exon 4 of 17 total exons.

  

499 AAGGATGCCCTGGAAAAGAATTCTCCAGGAGTT

111 -K--D--A--L--E--K--N--S--P--G--V-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 116 for a premature stop codon (K116*).

Protein Prediction
Figure 14. Domain structure of RasGRP1. Domain information is from SMART and UniProt. The grouper mutation results in substitution of lysine 116 for a premature stop codon. This image is interactive. Click on each mutation for more information.
Figure 15. Structure of human RasGRP1. Domains are colored as in Figure 14. Figure generated by UCSF Chimera and is based on PDB:4L9M.

Ras guanine-releasing protein 1 (RasGRP1) is a member of the Ras guanine nucleotide exchange factor (RasGEF) family that also includes the son of sevenless (SOS) proteins and the Ras guanine nucleotide releasing factors (RasGRFs). There are four members of the RasGRP subfamily: RasGRP-1, -2, -3 (see the record for aster), and -4. All of the RasGRPs have a central catalytic core, two EF hands, and a C1 domain (Figure 14) (1-3). The catalytic domain of the RasGEF proteins can be subdivided into a Cdc25/GEF domain and a Ras exchanger motif (REM). The C-terminus of RasGRP1 contains an unstructured region and a predicted coiled coil (alternatively, plasma membrane targeter [PT] domain) (3;4). A portion of the unstructured region adjacent to the PT domain was designated as a suppressor of PT (SuPT) domain.

 

The Cdc25/GEF domain binds directly with Ras to dislodge the bound nucleotide (5), while the REM is required for RasGEF activity. The REM domain controls the orientation of the helical hairpin of the Cdc25/GEF domain (6).EF hands are typically calcium-binding motifs (3). The C1 domain and the first EF hand domain are required for translocation of RasGRP1 to the plasma membrane upon receptor activation (4;7). The C1 and catalytic domains are both required for BCR-mediated Ras activation (8). The C1 domain of RasGRP1 binds diacylglycerol (DAG) (3). The PT domain is sufficient and essential for plasma membrane targeting of RasGRP1, while the SuPT domain attenuates the targeting activity of the PT domain to prevent constitutive plasma membrane localization of RasGRP1. A second study found that the C-terminal tail region containing the PT and SuPT domains is required for cell membrane trafficking, thymic selection, and ERK activation after TCR stimulation (9).

 

The structure of a human RasGRP1 fragment containing the REM, Cdc25/GEF, EF hand, and C1 domains has been solved [Figure 15; PDB:4L9M; (6)]. The Cdc25/GEF domain is comprised of 10 helices that form a compact bundle. Two antiparallel helices stick out from the core and form a hairpin. In SOS, Ras docks on the Cdc25/GEF bundle, while the hairpin splays a segment of Ras away from the rest of the protein (5;10). Ras is predicted to bind RasGRP1 in a similar manner (6). Without Ras•GTP bound, the helical hairpin of the RasGRP1 Cdc25/GEF domain is an open conformation to bind Ras. The EF hand and C1 domains interact with the Cdc25/GEF domain. The EF hands interact with one side of the Cdc25/GEF domain, while the C1 domain extends from the opposite side of the EF hand domain.

 

The grouper mutation results in substitution of lysine 116 for a premature stop codon (K116*); amino acid 110 is within the REM.

Expression/Localization

RasGRP1 is expressed in human and mouse T cell lines and thymocytes (11) as well as in human NK cells (12), B1 cells, and B2 cells (13). RasGRP1 expression was also noted in the nervous system (3).

Background
Figure 16. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors.

The RAS subfamily of GTPases link membrane receptor signals to internal signaling pathways through proteins including RAF and RalGDS. The RAS proteins are switches that cycle between inactive GDP (Ras-GDP)- and active GTP (Ras-GTP)-bound states. RasGEFs (e.g., RasGRP1, RasGRP3, and SOS) function as RAS activators by maintaining the active GTP-bound state. In contrast, Ras GTPase-activating proteins (RasGAPs) promote GTP hydroloysis, subsequently returning Ras-GTP to an inactive state. The Ras-RAF-MEK-ERK pathway is the best-characterized Ras-GTP-associated signaling pathway. RAS-associated signaling regulates several functions including cell proliferation, differentiation, and apoptosis as well as the development and activity of lymphocytes. 

 

Signaling through the T cell receptor (TCR) plays a critical role at multiple stages of thymocyte differentiation, T-cell activation, and homeostasis [Figure 16; reviewed in (14;15)]. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs). Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β for most T cells), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. Upon TCR crosslinking, the Src family kinases Lck (see iconoclast) and Fyn are recruited and activated, specifically phosphorylating ITAMs in CD3γ, δ, ε (see tumormouse) and ζ (see allia). These phosphorylated ITAMs then recruit ZAP-70 (ζ-chain-associated protein of 70 kDa; see murdock) and Syk (see poppy), which trans- and auto-phosphorylate, forming binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. ZAP-70 and Syk may also phosphorylate the linker for activation of T cells (LAT) and SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) (16). LAT binds to the adaptor proteins growth factor receptor-bound 2 (Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1. SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk; see itxaro), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1). These events lead to activation of multiple serine/threonine kinases, including MAP kinases, IκB kinases, and PKC family members, which ultimately regulate transcription factor activity (for a more detailed description of TCR-associated signaling, please see the record for murdock.

 

RasGRP1 is essential for the activation of the ERK/MAPK signaling cascade in T cells, the regulation of T- and B-cell development, and B cell proliferation as well as T cell homeostasis, survival, differentiation, and proliferation (11;17-24). GRB2 and DAG recruit SOS and RasGRP1, respectively, to the membrane after T cell receptor stimulation (11). At the membrane, RasGRP1 and SOS associate with membrane-anchored Ras. RasGRP1 primers SOS for activation by initiating a burst of Ras•GTP (25). The Ras•GTP activates SOS by binding SOS and stabilizing it at the plasma membrane, and subsequently promoting the conversion of Ras•GDP to Ras•GTP. Several functions of RasGRP1 are described below.

 

RasGRP1-facilitated Ras activation functions in positive selection of αβT cells (26). Rasgrp1-deficient (Rasgrp1-/-) mice had increased numbers of CD8+ γδT cells in the peripheral lymphoid organs; γδT cell numbers in the thymus were comparable to that in wild-type mice. RasGRP1-deficient γδT cells were defective in proliferation following TCR stimulation and showed impaired IL-17 production.

 

RasGRP1 is required for intrathymic development of CD4 Treg cells, but not for their peripheral expansion and function (26). RasGRP1 is not required for CD8+CD44highCD122+ Treg cell development. Rasgrp1-/- mice showed impaired CD4 Treg development in the thymus, but increased CD4+Foxp3+ Treg cells in the periphery (26). Also, the Rasgrp1-/- mice showed increased numbers of CD8+CD44highCD122+ T cells in the spleen.

 

RasGRP1 functions downstream of the chemokine receptor CXCR4, which is one of several receptors that drive β-selection (i.e., the checkpoint by which double-negative thymocytes enter before maturing into double-positive thymocytes) (27). RasGRP1 promotes ERK activation downstream of CXCR4. Thymi from Rasgrp1-/- mice exhibited a partial developmental block at the early DN3 stage.

 

RasGRP1 functions in the Ras-MAPK signaling pathway in NK cells, which subsequently leads to NK effector functions (12). Activating NK cell receptors (e.g., natural cytotoxicity receptors (NCRs) and NKG2D) signal through ITAM-containing adaptors, such as CD3ζ, FcRγ, DAP12, or DAP10. Src kinases phosphorylate the ITAM motifs (or YINM motif in DAP10), causing activation of downstream signaling proteins, including Vav proteins, PI3K, and PLC-γ. DAG activates RasGRP1. Signals are subsequently transmitted to MAPKs, which promote cytolytic granule release and cytokine generation (28).

 

RasGRP1 also functions in IgE-mediated signal transduction and mast cell function (29). Rasgrp1-/- mice did not mount anaphylactic allergic reactions. Mast cells from the Rasgrp1-/- mice showed reduced degranulation and cytokine production as well as aberrant granule translocation, microtubule formation and Rho activation.

 

A mutation in RASGRP1 was linked to a case of immunodeficiency (30). The patient with RasGRP1-associated immunodeficiency showed recurrent infections and failure to thrive. The patient showed a progressive reduction in the number of CD4+ T cells, an increased relative proportion of TCRγδ cells, a progressive decline in the number of B cells, and developed a low-grade Epstein-Barr virus (EBV)-associated B cell lymphoma. ERK phosphorylation was reduced in both B and T cells from the patient. NK cells from the patient showed impaired cytotoxicity with defective granule convergence and actin accumulation. Low levels of RasGRP1 as well as expression of aberrant RASGRP1 transcripts in T cells in humans are putatively associated with the development of autoimmunity in a subset of systemic lupus erythematosus patients (31). Increased levels of RASGRP1 are often found in pediatric T cell leukemia where it stimulates growth (32;33). Mutations in RASGRP1 have been associated with autoimmune diabetes  (34;35).

 

Rasgrp1-/- mice exhibited reduced numbers of peripheral B cells, CD4+ T cells, and CD8+ T cells, but increased numbers of CD4+ T cells with activated memory phenotype (17;24;36-38). The Rasgrp1-/- mice showed reduced numbers of invariant NKT cells (39). The Rasgrp1-/- mice exhibited enlarged spleens, increased levels of IgE and IgG1, and increased levels of autoantibody (24;36).

 

Homozygous mice for expressing a spontaneous Rasgrp1 mutation (Rasgrp1lag/lag) exhibited increased numbers of activated B cells and CD4+ T cells (40). The Rasgrp1lag/lag mice have enlarged spleens and livers as well as glomerulonephritis and increased serum levels of IgG (40). Homozygous mice expressing ENU-induced Rasgrp1 alleles exhibited aberrant T cell differentiation, increased numbers of effector memory CD4+ T cells, and subclinical autoimmune susceptibility [MGI and (37)].

 

Transgenic mice overexpressing RasGRP1 exhibited increased numbers of CD8+ thymocytes (41). Transgenic mice overexpressing RasGRP1 also exhibited thymic lymphomas independent of TCR-associated signaling (42). Overexpression of RasGRP1 promoted pre-TCR-independent survival and proliferation of immature thymocytes. RasGRP1 overexpression also resulted in the formation of spontaneous skin tumors (43;44).

Putative Mechanism

The phenotype(s) displayed by the grouper mice indicate that the mutation may affect the catalytic activity of RasGRP1grouper.

Primers PCR Primer
grouper(F):5'- CATCAGTGTGAGGAAGCCTACAC -3'
grouper(R):5'- ACTGCCTAGTTATGCATACATCAG -3'

Sequencing Primer
grouper_seq(F):5'- CCTACACAAGGCTGGGAGG -3'
grouper_seq(R):5'- GACAAAAGGGATCTCTTTCTAACTC -3'
References
  16. Pitcher, L. A., and van Oers, N. S. (2003) T-Cell Receptor Signal Transmission: Who Gives an ITAM? Trends Immunol. 24, 554-560.
Science Writers Anne Murray
AuthorsXue Zhong, Jin Huk Choi, Koichi Tabeta, Jeff SoRelle, and Bruce Beutler
List |< first << previous [record 23 of 132] next >> last >|