Phenotypic Mutation 'joplin' (pdf version)
List |< first << previous [record 87 of 132] next >> last >|
Allelejoplin
Mutation Type nonsense
Chromosome17
Coordinate34,193,258 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tap1
Gene Name transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Synonym(s) ABC transporter, MHC, 1; ABC17; antigen peptide transporter (APT1); ATP-binding cassette, subfamily B, member 2 (Abcb2); ATP-binding cassette, sub-family B (MDR/TAP), member 2; ATP-binding cassette transporter, major histocompatibility complex, 1; ATP dependent transport protein family member; histocompatibility antigen modifier 1 (Ham-1, Ham1); MTP1; peptide supply factor 1 (PSF-1); peptide transporter PSF1; RING4; transporter 1, ABC; transporter 1, ATP-binding cassette, sub-family B; transporter, ABC, MHC, 1; transporter, ATP-binding cassette, major histocompatibility complex, 1; transporter associated with antigen processing 1 (Tap-1, TAP); Y3
Chromosomal Location 34,187,553-34,197,225 bp (+)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This protein forms a heterodimer with Tap2 that transports short peptides from the cytosol into the endoplasmic reticulum lumen. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are deficient in antigen presentation, surface class I antigens, and CD4-8+ T cells. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013683NM_001161730; MGI: 98483

Mapped Yes 
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025196] [ENSMUSP00000039264] [ENSMUSP00000128401] [ENSMUSP00000134664]
SMART Domains Protein: ENSMUSP00000039264
Gene: ENSMUSG00000037321
AA Change: V451E

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 420 9.1e-55 PFAM
AAA 478 666 2.21e-18 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000041633)
SMART Domains Protein: ENSMUSP00000128401
Gene: ENSMUSG00000037321
AA Change: V479E

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 163 434 5.8e-70 PFAM
AAA 506 694 2.21e-18 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000170086)
SMART Domains Protein: ENSMUSP00000130189
Gene: ENSMUSG00000037321
AA Change: V148E

DomainStartEndE-ValueType
Pfam:ABC_membrane 1 114 1.5e-24 PFAM
Pfam:ABC_tran 167 196 1e-7 PFAM
Predicted Effect unknown
Phenotypic Category
Phenotypequestion? Literature verified References
FACS CD4:CD8 - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - decreased 10973281
Penetrance  
Alleles Listed at MGI

All mutations/alleles(6) : Chemically induced (ENU)(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
rose APN 17 34194940 missense probably damaging 1.00
IGL01294:Tap1 APN 17 34194045 critical splice donor site probably null
IGL01776:Tap1 APN 17 34193128 missense possibly damaging 0.82
IGL01787:Tap1 APN 17 34196604 missense probably benign 0.21
IGL02246:Tap1 APN 17 34193989 missense probably benign 0.01
IGL02996:Tap1 APN 17 34191396 missense probably damaging 1.00
IGL03278:Tap1 APN 17 34191483 missense probably damaging 1.00
rose2 UTSW 17 34194941 missense probably damaging 1.00
R1566:Tap1 UTSW 17 34189546 missense probably benign 0.00
R1795:Tap1 UTSW 17 34194925 missense probably benign 0.21
R1837:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1839:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R1892:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1893:Tap1 UTSW 17 34194941 missense probably damaging 1.00
R1952:Tap1 UTSW 17 34193507 missense probably damaging 1.00
R2163:Tap1 UTSW 17 34189473 unclassified probably null
R3744:Tap1 UTSW 17 34193612 missense probably damaging 1.00
R3883:Tap1 UTSW 17 34193258 missense probably damaging 1.00
R3975:Tap1 UTSW 17 34189567 unclassified probably benign
R4418:Tap1 UTSW 17 34188379 unclassified probably null
R4779:Tap1 UTSW 17 34193891 missense probably damaging 1.00
R4913:Tap1 UTSW 17 34193494 missense possibly damaging 0.94
R5715:Tap1 UTSW 17 34192894 nonsense probably null
R5838:Tap1 UTSW 17 34193305 nonsense probably null
R6248:Tap1 UTSW 17 34193177 missense probably damaging 0.99
R6710:Tap1 UTSW 17 34188109 missense possibly damaging 0.50
R6881:Tap1 UTSW 17 34188034 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2017-09-15 10:43 AM by Anne Murray
Record Created 2017-08-28 1:47 PM by Bruce Beutler
Record Posted 2017-09-15
Phenotypic Description

Figure 1. Joplin mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Joplin mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Joplin mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Joplin mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The joplin phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3883, some of which exhibited an increase in the CD4 to CD8 T cell ratio (Figure 1) due to reduced frequencies of CD8+ T cells (Figure 2) and CD8+ T cells in CD3+ T cells (Figure 3) with concomitant increased frequencies of CD4+ T cells in CD3+ T cells (Figure 4), all in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the reduced CD8+ T cells in CD3+ T cells frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R3883. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tap1:  a T to A transversion at base pair 34,193,258 (v38) on chromosome 17, or base pair 5,703 in the GenBank genomic region NC_000083. The strongest association was found with a recessive model of inheritance to the reduced CD8+ T cells in CD3+ T cells frequency phenotype, wherein two variant homozygotes departed phenotypically from two homozygous reference mice and seven heterozygous mice with a P value of 2.47 x 10-8 (Figure 5).  

 

The mutation corresponds to residue 1,760 in the mRNA sequence NM_013683 (variant 1) within exon 7 of 11 total exons or residue 1,676 in the mRNA sequence NM_001161730 (variant 2) within exon 8 of 12 total exons.

 

5687 AACATGAAAGGCCTTGTGGAGTTCCAAGATGTC

474  -N--M--K--G--L--V--E--F--Q--D--V- (isoform 1; NP_038711)

446  -N--M--K--G--L--V--E--F--Q--D--V- (isoform 2; NP_001155202)

 

Genomic numbering corresponds to NC_000083. The mutated nucleotide is indicated in red. The mutation results in a valine (V) to glutamic acid (E) substitution at position 479 (V479E) in isoform 1 and a V to E substitution at position 451 (V451E) in isoform 2 of the TAP1 protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.00) (1).

Protein Prediction
Figure 6. Predicted membrane topology of TAP. Both TAP1 and TAP2 contain a 6-helix core transmembrane domain (TMD; purple) and a cytosolic nucleotide binding domain (NBD). Tapasin binding N-terminal accessory domains (pink) consist of 4 and 3 transmembrane helices for TAP1 and TAP2, respectively. The Walker A (A), Walker B (B), and signature/C-loop motif (C) sequences, involved in ATP binding and/or hydrolysis, and color coded to indicate to which ATPase site they belong (green = consensus site,; orange = degenerate site). The joplin mutation is indicated. The image is interactive, click to view other Tap1 mutations.

Transporter associated with antigen processing (TAP) is a member of the ATP-binding cassette (ABC) transporter family, ubiquitous proteins that shuttle a variety of substrates, including ions (see record for mayday), sugars, amino acids, peptides, vitamins, lipids, antibiotics, and drugs, across cellular membranes (2;3). All ABC transporters possess a modular architecture, the core of which consists of two hydrophobic transmembrane domains (TMDs) and two cytosolic nucleotide-binding domains (NBDs; also called ABCs) (4). TAP is a heterodimer of the homologous TAP1 and TAP2 (see the record for ganymede) proteins, each of which contains a six-helix TMD and a C-terminal NBD (Figure 6(5;6). TAP1 and TAP2 also contain N-terminal accessory domains, non-essential for peptide transport, that bind to tapasin, the specialized chaperone that bridges TAP and class I MHC molecules in the peptide loading complex (6;7). The accessory domain of TAP1 consists of four transmembrane helices (5;6).

 

The joplin mutation occurs in cytoplasmic tail of Tap1.

 

Please see the record rose for information about Tap1.

Putative Mechanism

The TAP complex pumps cytosolic peptides into the endoplasmic reticulum (ER) lumen for loading onto class I major histocompatibility (MHC) molecules and presentation to T lymphocytes. Peptide binding is required to stabilize MHC class I molecules, so mice with disrupted TAP1 or TAP2 genes assemble drastically reduced amounts of MHC class I molecules, and have nearly absent surface expression of MHC class I. Mutations in TAP1 (8;9) cause the rarely occurring bare lymphocyte syndrome type I (type I BLS, OMIM #604571), characterized a reduction in MHC class I surface expression to 1-3% of normal levels. Patients with type I BLS from TAP1 or TAP2 mutations develop chronic bacterial infections of the sinus and bronchi in late childhood and/or granulomatous skin lesions, but no severe combined immunodeficiency, diarrhea, nor persistent systemic infections (10;11). The phenotypes of the joplin mice mimics that of rose and ganymede, indicating loss of TAP1joplin (and TAP1/TAP2) function.

Primers PCR Primer
joplin(F):5'- AAGCAGGTTAGACGGCTCAC -3'
joplin(R):5'- TTCCAGGATGCAGGGTGAAC -3'

Sequencing Primer
joplin_seq(F):5'- AGACGGCTCACTTGCTTTCG -3'
joplin_seq(R):5'- TGCAGGGTGAACGTCAGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 87 of 132] next >> last >|