Phenotypic Mutation 'asilomar' (pdf version)
Alleleasilomar
Mutation Type missense
Chromosome4
Coordinate150,929,874 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tnfrsf9
Gene Name tumor necrosis factor receptor superfamily, member 9
Synonym(s) A930040I11Rik, Cd137, Ly63, ILA, CDw137, 4-1BB
Chromosomal Location 150,914,562-150,946,102 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contributes to the clonal expansion, survival, and development of T cells. It can also induce proliferation in peripheral monocytes, enhance T cell apoptosis induced by TCR/CD3 triggered activation, and regulate CD28 co-stimulation to promote Th1 cell responses. The expression of this receptor is induced by lymphocyte activation. TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced T cell proliferation, decreased B cell IgG production, decreased cytotoxic T cell activity, and increased numbers of erythrocytes, granulocyte macrophages, and multipotential progenitor cells in the bone marrow, blood, and spleen. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011612, NM_001077508, NM_001077509; MGI:1101059

Mapped Yes 
Amino Acid Change Valine changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000030808] [ENSMUSP00000059684] [ENSMUSP00000101296] [ENSMUSP00000101297] [ENSMUSP00000111961] [ENSMUSP00000122917] [ENSMUSP00000120761] [ENSMUSP00000117860] [ENSMUSP00000127916]
PDB Structure
STRUCTURE OF TNF RECEPTOR ASSOCIATED FACTOR 2 IN COMPLEX WITH A M4-1BB PEPTIDE [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000030808
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
(Using ENSMUST00000030808)
SMART Domains Protein: ENSMUSP00000059684
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
(Using ENSMUST00000060901)
SMART Domains Protein: ENSMUSP00000101296
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
(Using ENSMUST00000105671)
SMART Domains Protein: ENSMUSP00000101297
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 1.1e-8 SMART
TNFR 119 158 5.4e-5 SMART
low complexity region 201 208 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
(Using ENSMUST00000105672)
SMART Domains Protein: ENSMUSP00000111961
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
low complexity region 246 253 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
(Using ENSMUST00000116257)
SMART Domains Protein: ENSMUSP00000122917
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
transmembrane domain 189 211 N/A INTRINSIC
Predicted Effect probably benign

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
(Using ENSMUST00000126707)
SMART Domains Protein: ENSMUSP00000120761
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
(Using ENSMUST00000135169)
SMART Domains Protein: ENSMUSP00000117860
Gene: ENSMUSG00000028965
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 47 85 2.36e-6 SMART
TNFR 119 158 1.11e-2 SMART
Predicted Effect probably benign

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
(Using ENSMUST00000139826)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - increased
FACS B:T cells - increased
FACS CD8+ T cells - decreased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD+ B cell percentage - increased
FACS IgM+ B cells - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(23) : Endonuclease-mediated(2) Gene trapped(12) Targeted(9)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Tnfrsf9 UTSW 4 150934395 intron probably benign
FR4342:Tnfrsf9 UTSW 4 150934394 intron probably benign
R1496:Tnfrsf9 UTSW 4 150933104 critical splice donor site probably null
R1870:Tnfrsf9 UTSW 4 150934347 nonsense probably null
R5596:Tnfrsf9 UTSW 4 150929874 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-09-07 10:08 AM by Anne Murray
Record Created 2017-08-29 9:50 AM by Bruce Beutler
Record Posted 2018-09-07
Phenotypic Description
Figure 1. Asilomar mice exhibit decreased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Asilomar mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Asilomar mice exhibit decreased frequencies of peripheral naïve CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Asilomar mice exhibit decreased frequencies of peripheral naïve CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Asilomar mice exhibit increased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Asilomar mice exhibit increased frequencies of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Asilomar mice exhibit increased frequencies of peripheral IgM+ B cells​​​​. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Asilomar mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Asilomar mice exhibit increased frequencies of peripheral effector memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The asilomar phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5596, some of which showed in increase in the B to T cell ratio (Figure 1) due to reduced frequencies of CD8+ T cells (Figure 2), naïve CD4 T cells in CD4 T cells (Figure 3) and naïve CD8 T cells in CD8 T cells (Figure 4) with concomitant increased frequencies of B cells (Figure 5), IgD+ B cells (Figure 6), IgM+ B cells (Figure 7), effector memory CD4 T cells in CD4 T cells (Figure 8), and effector memory CD8 T cells in CD8 T cells (Figure 9).

Nature of Mutation

Figure 10. Linkage mapping of the increased B to T cell ratio phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 44 mutations (X-axis) identified in the G1 male of pedigree R5596. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 44 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tnfrsf9:  a T to C transition at base pair 150,929,874 (v38) on chromosome 4, or base pair 9,720 in the GenBank genomic region NC_000070 encoding Tnfrsf9. The strongest association was found with a recessive model of inheritance to the normalized B:T ratio, wherein two variant homozygotes departed phenotypically from nine homozygous reference mice and 10 heterozygous mice with a P value of 1.53 x 10-7 (Figure 10).  

 

The mutation corresponds to residue 160 in the mRNA sequence NM_011612 within exon 1 of 8 total exons.


 
144 TGTTACAACGTGGTGGTCATTGTGCTGCTGCTA
5   -C--Y--N--V--V--V--I--V--L--L--L-

 

The mutated nucleotide is indicated in red. The mutation results in a valine to alanine substitution at position 10 (V10A) in the CD137 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.015).

Protein Prediction
Figure 11. Domain organization of CD137. The asilomar mutation results in a valine to alanine substitution at position 10 in the CD137 protein. Secondary structure is noted. Abbreviations: SP, signal peptide; CRD, cysteine-rich domain; TM, transmembrane domain.
Figure 12. Crystal structure of the extracellular domain of human CD137. β-strands are represented by arrows and α-helices by coils. UCSF Chimera structure is based on PDB 6BWV. Click on the 3D structure to view it rotate. 

Tnfrsf9 encodes CD137 (alternatively, 4-1BB, TNFRSF9 [tumor necrosis factor receptor (TNFR) superfamily member 9], or ILA [induced by lymphocyte activation]). CD137 is a member of the TNFR family, which also includes Fas (alternatively, TNFR6; see the record for cherry), CD40 (see the record for bluebonnet), and lymphotoxin β receptor (LTβR; see the record for kama).

 

Similar to other members of the TNFR family, CD137 is a single-pass type-I transmembrane-spanning protein. CD137 has a signal peptide, four cysteine-rich domains (CRDs) in the extracellular domain, and a C-terminal cytoplasmic region [Figure 11 & 12; (1); PDB:5WJF (2); PDB:6BWV (3)]. Mouse CD137 has two TNF receptor-associated factor (TRAF)-binding sites within the cytoplasmic region that can recruit TRAF1 and TRAF2 (4). Human CD137 can also recruit TRAF3 (see the record for hulk) (5).

 

The extracellular region of CD137 has an elongated jellyroll β-sandwich fold consisting of two β-sheets (Figure 12) (3). The CRDs (namely CRD1, CRD2, and CRD3) mediate ligand binding (2;3;6). The cysteine residues within the CRDs participate in intradomain disulfide bridges (CRD1 and CRD4 have two each, CRD2 and CRD3 have 3 each) that promote the stability of the ectodomain (2;7). CD137 is N-linked glycosylated at Asn128 and Asn138 within CRD4 (2). CD137 glycosylation mediates binding to galectin-9, which putatively functions in regulating CD137 signaling (2).

 

Tnfrsf9 produces two isoforms through alternative splicing: the canonical transmembrane-spanning protein (CD137) and a soluble form (sCD137) (8). Human sCD137 is released by activated lymphocytes and putatively negatively regulates immune responses by either competitive binding to the CD137 ligand or by inserting into CD137 trimers/dimers on the cell surface (9;10). Increased levels of sCD137 have been noted in the sera of patients with chronic lymphocytic leukemia (11), rheumatoid arthritis (12), multiple sclerosis (13;14), systemic lupus erythematosus, and Behcet’s disease [reviewed in (15)].

Expression/Localization

CD137 is expressed by activated T cells (not resting T cells) (16), regulatory T cells (17), activated natural killer T cells (18), B cells (19), dendritic cells (20-22), monocytes (23), eosinophils (24), neutrophils (25;26), activated NK cells (27;28), mast cells (29), vascular endothelial cells (30), and chondrocytes (6) [reviewed in (31)].

Background

The ligand for CD137, CD137L (alternatively, 4-1BBL or TNFSF9), is a type II transmembrane protein and member of the TNF (see the record for Panr1) superfamily. CD137L is expressed on antigen-presenting cells (APCs; e.g., B cells dendritic cells, and macrophages). CD137/CD137L-associated signaling mediates the activation, proliferation, survival, apoptosis, and differentiation of several immune cell types as well as preventing activation-induced cell death, promoting cell cycle progression, enhancing cytotoxicity and the production of type 1 cytokines (Table 1). More information about CD137-associated signaling is detailed, below.

 

Table 1. CD137/CD137L-associated functions

Cell type

CD137-related function

References

T cells

Regulates activation and survival; (human) inhibits proliferation and induces apoptosis; (mouse) inhibits proliferation; induces interferon release and subsequent inhibition of Th2-mediated allergic lung inflammation

(10;32-36)

Monocytes/macrophages

Proliferation, activation, migration, survival, and cell growth

(23;30;34;37)

Dendritic cells

Maturation; increased production of inflammatory cytokines IL-6 and IL-12 as well as enhanced DC-mediated T cell activation

(21;22;38-40)

B cells

Proliferation; immunoglobulin secretion

(20;41)

Mast cells

Activation and cytokine production

(29)

Neutrophils

Stimulates expression/secretion of IL-6, TNFα, IL-1β, IL-1Rα, migration inhibitory factor, lymphotactin, macrophage inflammatory protein-1α, IFN-γ-inducible protein-10 and thymus-derived chemotactic agent; increased phagocytic ability

(26)

Natural killer cells

Cell survival; increased activity; promotes expansion of activated T cells

(18;28;42)

Eosinophils

IgE-mediated allergic responses; eosinophils from IgE-mediated asthma and atopic dermatitis patients expressed CD137, while cells from healthy patients or from patients with non-IgE-mediated asthma did not

(24)

 

Figure 13. CD137/CD137L signaling. Binding of CD137L to CD137 results in recruitment of tumor necrosis factor receptor‐associated factor 1 (TRAF1) and TRAF2 leading to activation of the non-canonical NF-κB (NF-κB2) signaling pathway as well as the extracellular signal regulated kinase (ERK), c‐Jun N‐terminal kinase (JNK), and p38 MAPK signaling cascades. In the non-canonical pathway, the receptors bind to TRAFs to regulate NIK activity. TRAF3 and TRAF2 are recruited to the receptor along with cIAP1/2. TRAF2 undergoes K63 self-ubiquitination and is responsible for the K63 ubiquitination of cIAP1/2. TRAF3 is degraded by K48 ubiquitination, enhanced by the K63 ubiquitination of TRAF2 and cIAP1/2. As TRAF levels decrease, NIK is released and phosphorylates IKKα which phosphorylates p100. Phosphorylation and ubiquitination of p100 leads to the 26S proteasomal degradation of p100 and the processing of p52. P52 and RelB are released for translocation to the nucleus. CD137/CD137L participate in bidirectional signaling. In humans, CD137L-associated signaling activates Src tyrosine kinases, p38 MAPK, MEK1/2, ERK1/2, PI3K, and NF-κB, leading to antigen presenting cell activation and differenation. In the mouse, CD137L-associated signaling induces M-CSF and IL-1β secretion through Src tyrosine kinase/mTOR/p70S6K and Src tyrosine kinase/AKT pathways. See the text for more details. This image is interactive; click on mutants to view more information.

Binding of CD137L to CD137 activates the non-canonical NF-κB (NF-κB2; see the record for xander) signaling pathway (Figure 13) (4;5). The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers. The receptors involved in non-canonical signaling (e.g., lymphotoxin-β receptor [LTβR; see the record for kama], B cell activating receptor [BAFFR; see the record for tannin], CD40 [see the record for bluebonnet], receptor activator of NF-κB [RANK] and TNF-related weak inducer of apoptosis [TWEAK]) are involved in secondary lymphoid organogenesis (SLO), B cell differentiation, survival and homeostasis, osteoclastogenesis, and angiogenesis (43), and bind to TNF receptor associated factors (TRAFs) to regulate NIK activity. Downstream of the receptors, TRAF2 and TRAF3 form a complex with NIK to mediate NIK degradation (44-47). After receptor stimulation, the complex is destabilized by TRAF2/3 degradation, permitting the release of NIK from the complex (45-47). After NIK is activated, it is able to bind to and phosphorylate several substrates including IKK-1 and p100, and serves as a docking molecule between IKK-1 and p100 (48-50). Phosphorylation of p100 by IKK-1 results in polyubiquitination and processing to p52 (49). NIK also activates mitogen‐associated protein kinases (MAPKs) through MAP/ERK kinase kinases and MAPK kinases. The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression. Typically, the rapid and transient activation of NF-κB complexes in response to a wide range of stimuli such as proinflammatory cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and CD40L (see the record for walla). CD137-associated NF-κB activation promotes an increase in the expression of anti-apoptotic proteins including Bcl-2 and Bcl-XL.

 

CD137L/CD137 activation also leads to activation of the extracellular signal regulated kinase (ERK), c‐Jun N‐terminal kinase (JNK), and p38 MAPK signaling cascades (4;32;33;51;52). CD137 activation results in recruitment of TRAF1 and TRAF2, which activates the ERK, JNK, and p38 MAPK pathways. TRAF2 promotes ASK1 (Apoptosis Signal-Regulating Kinase-1) recruitment and activation. ASK1 activates the JNK and MAPK pathways. Activation of the ERK, JNK, and p38 MAPK pathways promotes cell cycle progression and cell survival.

 

CD137L/CD137 participate in bidirectional signaling (Figure 13). Several signaling factors involved in CD137L reverse signaling have been identified, including p38, ERK1/2, PI3K, and PKA (53). Reverse signaling results in cytokine production as well as survival, proliferation, migration, and differentiation of APCs. In humans, CD137L-associated signaling activates Src tyrosine kinases, p38 MAPK, MEK1/2, ERK1/2, PI3K, and NF-κB, leading to antigen presenting cell activation and differenation. In the mouse, CD137L-associated signaling induces M-CSF and IL-1β secretion through Src tyrosine kinase/mTOR/p70S6K and Src tyrosine kinase/AKT pathways.

 

CD137 is an inducer of antitumor immune responses (54-56), and CD137 agonists used with cancer vaccines and immune checkpoint inhibitors boost anticancer immune responses (57;58). CD137 antibodies can increase anti-pathogen immune responses and transplant rejections as well as improve several mouse model autoimmune diseases, including systemic lupus erythematosus (59), collagen-induced arthritis (60), uveoretinitis (61), experimental autoimmune encephalomyelitis (62),  allergic airway inflammation and asthma (63;64), inflammatory bowel disease (65), and chronic graft vs. host disease (66).

 

Some Tnfrsf9-deficient (Tnfrsf9-/-) mice exhibited preweaning lethality (MGI). Tnfrsf9-/- mice exhibited insulitis in non-diabetic female mice at 30 weeks (67). Tnfrsf9-/- mice showed reduced levels of IgG2a and IgG3 in response to KLH immunization, increased levels of IgA, IgG2a, and IgG2b in naïve mice, and increased absolute numbers of granulocyte-macrophage, erythroid, and multipotential progenitor cells in the bone marrow, blood, and spleen (68;69). The Tnfrsf9-/- mice showed reduced IL-2 and IL-4 secretion from T cells, increased T cell proliferation after stimulation with anti-CD3 and ConA, and reduced cytotoxic T lymphocyte activity to vesicular stomatitis virus (68). Tnfrsf9-/- mice also showed increased dendritic cell frequencies and reduced dendritic cell survival rates as well as reduced NK/NK T cell numbers and functions (18). Tnfrsf9-/- mice showed increased effector CD4 T cell responses to OVA protein in adjuvant (70). Heterozygous mice (Tnfrsf9+/-) mice show increased bone mineral content and bone mineral density (MGI).

Putative Mechanism

The phenotype of the asilomar mice indicates loss of CD137asilomar function mediating T cell survival.

Primers PCR Primer
asilomar(F):5'- AGAATGACACTTGTGAGATATCCC -3'
asilomar(R):5'- GGCTGCTTTGTTGGATTCAA -3'

Sequencing Primer
asilomar_seq(F):5'- TGGGGTTACAGCATCCACTAC -3'
asilomar_seq(R):5'- AGTCGGTGCTCTTAACCAAAGTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler