Phenotypic Mutation 'dregs'

• Allele: dregs
• Mutation Type: splice site
• Chromosome: 7
• Coordinate: 127,866,677 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Slc5a2
• Gene Name: solute carrier family 5 (sodium/glucose cotransporter), member 2
• Synonym(s): Sglt2
• Chromosomal Location: 127,864,855-127,871,602 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015] ; PHENOTYPE: Mice homozygous for a null allele exhibit increased urine glucose, increased eating and drinking behaviors, increased circulating renin activity, decreased urine osmolality, decreased serum aldosterone levels, polyuria, and decreased glucose renal reabsorption. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000145789 ^†] [ENSMUSP00000112597 ^†] [ENSMUSP00000124318] [ENSMUSP00000115451 ^†] [ENSMUSP00000145739 ^†] [ENSMUSP00000145581 ^†] [ENSMUSP00000145699] † probably from a misspliced transcript
• AlphaFold: Q923I7
• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000112597; Gene: ENSMUSG00000030781

Domain	Start	End	E-Value	Type
Pfam:SSF	53	490	7e-170	PFAM
transmembrane domain	524	546	N/A	INTRINSIC
low complexity region	566	577	N/A	INTRINSIC
low complexity region	615	635	N/A	INTRINSIC
transmembrane domain	650	669	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000124318; Gene: ENSMUSG00000030781

Domain	Start	End	E-Value	Type
Pfam:SSF	1	103	3.3e-41	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000115451; Gene: ENSMUSG00000030781

Domain	Start	End	E-Value	Type
Pfam:SSF	53	276	5.7e-81	PFAM

• Predicted Effect: probably null
• Predicted Effect: probably null
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-08-31 8:18 AM by Bruce Beutler
• Record Posted: 2018-04-11
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Lei Sun, Zhao Zhang, Hexin Shi, Emre Turer, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_133254; MGI:2384572

Alleles Listed at MGI

All Mutations and Alleles(4) : Chemically induced (ENU)(1) Targeted(3)

Phenotypic Description

Figure 1. Dregs mice exhibited increased body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dregs mice exhibited increased TNFα secretion in response to TLR9 ligand, CpG (primed with IFNγ). TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Dregs mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days post-DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The dregs phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4836, some of which showed increased body weights compared to wild-type littermates (Figure 1). Some mice also exhibited increased TNFα secretion in response to TLR9 ligand, CpG (primed with IFNγ) (Figure 2) and susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days post-DSS treatment (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the increased TNFα secretion after CpG stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 79 mutations (X-axis) identified in the G1 male of pedigree R4836. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 79 mutations. Both of the above anomalies were linked to a mutation in Slc5a2:  an A to G transition at base pair 128,267,505 (v38) on chromosome 7, or base pair 1,809 in the GenBank genomic region NC_000073 within the donor splice site of intron 4. The strongest association was found with a recessive model of inheritance to the normalized TLR9 phenotype, wherein two variant homozygotes departed phenotypically from seven homozygous reference mice and 16 heterozygous mice with a P value of 1.03 x 10^-10 (Figure 4).

The effect of the mutation at the cDNA and protein levels has not been examined, and the splicing prediction program has not been run for the transcript of interest. The mutation may result in skipping of the 165-base pair exon 4, which would result in an in-frame deletion of amino acids 100 to 154 in the SGLT2 protein, which is normally 670 amino acids long.

<--exon 3      <--exon 4 intron 4-->        exon 5-->          <--exon 14 286 ……TTTGAGTGGAAT ……ACCAAGATCTCG gtgagcacgtgtggtg…… GTGGATATGTTC…… ……TTCTATGCATAA 96  ……-F--E--W--N- ……-T--K--I--S-                    -V--D--M--F-…… ……-F--Y--A--*-         correct        deleted                               correct

The donor splice site of intron 4, which is destroyed by the dregs mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 5. SGLT2 topology. The 670 amino acid SGLT2 protein has 14 transmembrane spanning domains and the N- and C-termini are extracellular. Mouse SGLT2 is N-glycosylated at Asn 248 between transmembrane domains six and seven. The dregs mutation results in an A to G transition within the donor splice site of intron 4. Mutations found within SGLT2 are noted in red. Click on the mutation to view more information.

The Slc5a2 (alternatively, Sglt2) gene encodes the 670 amino acid SGLT2 protein, a member of the solute carrier family V transporter family (SLC5; alternatively, sodium (Na⁺) substrate symporter gene family (SSSF)) [(1;2); reviewed in (3)]. SGLT2 has 14 transmembrane-spanning domains and the N- and C-termini are extracellular, although most of the C-terminus comprises transmembrane domain 14 [(4;5); reviewed in (3;6-8)]. Several studies propose that transmembrane domains 10 through 13 in the SGLT proteins are essential to bind and translocate the sugar substrate [(4;9-11); reviewed in (3)].  SGLT2 mutations within transmembrane domains two, three, four, and eight can also cause glucosuria, indicating that these domains are functionally significant, although this has not been further studied (3;9;12). Within the fifth transmembrane domain is an SSSF consensus sequence [GS]-2(2)-[LIY]-x(3)-[LIVMFYWSTAG](7)-x(3)-[LIY]- [STAV]-x(2)-G-G-[LMF]-x-[SAP] (7;13).  The second motif, a SGLT/SMIT consensus sequence [R-xT-x-x-x-x-F-L-A-G-x-x-x-x-W-W-x-x-G-A-S-], is near the N-terminus (13).

Please see the record jimbee for more information about Slc5a2.

Putative Mechanism

In the mouse, Sglt2 is almost exclusively expressed in the kidney; Sglt2 mRNA was not detected in mouse extrarenal organs (14). SGLTs of the proximal tubule (i.e., SGLT2) facilitate the transport of glucose from the lumen into the renal epithelial cell. The SGLT1 and SGLT2 proteins are Na⁺/glucose co-transporters and act via secondary active transport (6;7;15). Glucose transport is coupled to Na⁺ transport, which is powered by a Na⁺ electrochemical gradient [(16;17); reviewed in (3;18;19)]. Knockout mouse models of Slc5a2 (18;20;21), and humans with mutations in SLC5A2 (3;9;7;12;22-25) have shown that SGLT2 is essential for the reabsorption of glucose in the kidney.  Due to the failure in renal glucose reabsorption, Sglt2 mutant mice exhibit osmotic diuresis and excessive thirst (18;20;21). 

Primers

PCR Primer
dregs_pcr_F: ATTTGTTCCCACAGGCGCTC
dregs_pcr_R: ATCCATCCTGTGTGGCCATAC

Sequencing Primer
dregs_seq_F: ACAGGCGCTCTTCGTGGTG
dregs_seq_R: AGAAATCTGAGTGCCTCTGC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 518 nucleotides is amplified (chromosome 7, + strand):

1   atttgttccc acaggcgctc ttcgtggtgc tgctcctcgg atggcttttt gtgccagtgt
61  atctgaccgc tggtgtgatc acaatgcctc agtacctccg caagcgcttt ggtgggcacc
121 gtattcgcct ctacctgtcc gtgctctcgc tttttttgta cattttcacc aagatctcgg
181 tgagcacgtg tggtgggcgg tacagacgct tagaaaggta gaaccaccca gtgaagtctt
241 cagagacctc tggaaggggc gggaacaagg agaaaagcaa gaatcagcat gaggggtggg
301 gcctggaaag agcaagtctc caagctgtgg gtacagtact cgggacctgg gaagaccagg
361 ttgttgccag gtgtggtggc acatgccttt aatcccagca cttgggaggc agaggcactc
421 agatttctga gttcgaggcc agcctggtct gcaaagtgag ttccaggaca gcaaaaaaaa
481 aagaatgggt ttttgaggta tggccacaca ggatggat

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wells, R. G., Mohandas, T. K., and Hediger, M. A. (1993) Localization of the Na+/glucose Cotransporter Gene SGLT2 to Human Chromosome 16 Close to the Centromere. Genomics. 17, 787-789.

  2. Wells, R. G., Pajor, A. M., Kanai, Y., Turk, E., Wright, E. M., and Hediger, M. A. (1992) Cloning of a Human Kidney cDNA with Similarity to the Sodium-Glucose Cotransporter. Am. J. Physiol.. 263, F459-65.

  3. Magen, D., Sprecher, E., Zelikovic, I., and Skorecki, K. (2005) A Novel Missense Mutation in SLC5A2 Encoding SGLT2 Underlies Autosomal-Recessive Renal Glucosuria and Aminoaciduria. Kidney Int.. 67, 34-41.

  4. Turk, E., and Wright, E. M. (1997) Membrane Topology Motifs in the SGLT Cotransporter Family. J. Membr. Biol.. 159, 1-20.

  5. Faham, S., Watanabe, A., Besserer, G. M., Cascio, D., Specht, A., Hirayama, B. A., Wright, E. M., and Abramson, J. (2008) The Crystal Structure of a Sodium Galactose Transporter Reveals Mechanistic Insights into Na+/sugar Symport. Science. 321, 810-814.

  6. Sabino-Silva, R., Mori, R. C., David-Silva, A., Okamoto, M. M., Freitas, H. S., and Machado, U. F. (2010) The Na(+)/glucose Cotransporters: From Genes to Therapy. Braz. J. Med. Biol. Res.. 43, 1019-1026.

  7. Santer, R., and Calado, J. (2010) Familial Renal Glucosuria and SGLT2: From a Mendelian Trait to a Therapeutic Target. Clin. J. Am. Soc. Nephrol.. 5, 133-141.

  8. Wright, E. M., and Turk, E. (2004) The sodium/glucose Cotransport Family SLC5. Pflugers Arch.. 447, 510-518.

  9. Santer, R., Kinner, M., Lassen, C. L., Schneppenheim, R., Eggert, P., Bald, M., Brodehl, J., Daschner, M., Ehrich, J. H., Kemper, M., Li Volti, S., Neuhaus, T., Skovby, F., Swift, P. G., Schaub, J., and Klaerke, D. (2003) Molecular Analysis of the SGLT2 Gene in Patients with Renal Glucosuria. J. Am. Soc. Nephrol.. 14, 2873-2882.

  10. Panayotova-Heiermann, M., Loo, D. D., Kong, C. T., Lever, J. E., and Wright, E. M. (1996) Sugar Binding to Na+/glucose Cotransporters is Determined by the Carboxyl-Terminal Half of the Protein. J. Biol. Chem.. 271, 10029-10034.

  11. Wright, E. M. (2001) Renal Na(+)-Glucose Cotransporters. Am. J. Physiol. Renal Physiol.. 280, F10-8.

  12. Yu, L., Lv, J. C., Zhou, X. J., Zhu, L., Hou, P., and Zhang, H. (2011) Abnormal Expression and Dysfunction of Novel SGLT2 Mutations Identified in Familial Renal Glucosuria Patients. Hum. Genet.. 129, 335-344.

  13. Wright, E. M., Loo, D. D., Hirayama, B. A., and Turk, E. (2004) Surprising Versatility of Na+-Glucose Cotransporters: SLC5. Physiology (Bethesda). 19, 370-376.

  14. Sabolic, I., Vrhovac, I., Eror, D. B., Gerasimova, M., Rose, M., Breljak, D., Ljubojevic, M., Brzica, H., Sebastiani, A., Thal, S. C., Sauvant, C., Kipp, H., Vallon, V., and Koepsell, H. (2012) Expression of Na+-D-Glucose Cotransporter SGLT2 in Rodents is Kidney-Specific and Exhibits Sex and Species Differences. Am. J. Physiol. Cell. Physiol.. 302, C1174-88.

  15. Bakris, G. L., Fonseca, V. A., Sharma, K., and Wright, E. M. (2009) Renal Sodium-Glucose Transport: Role in Diabetes Mellitus and Potential Clinical Implications. Kidney Int.. 75, 1272-1277.

  16. Hediger, M. A., Kanai, Y., You, G., and Nussberger, S. (1995) Mammalian Ion-Coupled Solute Transporters. J. Physiol.. 482, 7S-17S.

  17. Hediger, M. A., and Rhoads, D. B. (1994) Molecular Physiology of Sodium-Glucose Cotransporters. Physiol. Rev.. 74, 993-1026.

  18. Jurczak, M. J., Lee, H. Y., Birkenfeld, A. L., Jornayvaz, F. R., Frederick, D. W., Pongratz, R. L., Zhao, X., Moeckel, G. W., Samuel, V. T., Whaley, J. M., Shulman, G. I., and Kibbey, R. G. (2011) SGLT2 Deletion Improves Glucose Homeostasis and Preserves Pancreatic Beta-Cell Function. Diabetes. 60, 890-898.

  19. Schmidt, C., Hocherl, K., and Bucher, M. (2007) Regulation of Renal Glucose Transporters during Severe Inflammation. Am. J. Physiol. Renal Physiol.. 292, F804-11.

  20. Ly, J. P., Onay, T., Sison, K., Sivaskandarajah, G., Sabbisetti, V., Li, L., Bonventre, J. V., Flenniken, A., Paragas, N., Barasch, J. M., Adamson, S. L., Osborne, L., Rossant, J., Schnermann, J., and Quaggin, S. E. (2011) The Sweet Pee Model for Sglt2 Mutation. J. Am. Soc. Nephrol.. 22, 113-123.

  21. Vallon, V., Platt, K. A., Cunard, R., Schroth, J., Whaley, J., Thomson, S. C., Koepsell, H., and Rieg, T. (2011) SGLT2 Mediates Glucose Reabsorption in the Early Proximal Tubule. J. Am. Soc. Nephrol.. 22, 104-112.

  22. Freitas, H. S., Anhe, G. F., Melo, K. F., Okamoto, M. M., Oliveira-Souza, M., Bordin, S., and Machado, U. F. (2008) Na(+) -Glucose Transporter-2 Messenger Ribonucleic Acid Expression in Kidney of Diabetic Rats Correlates with Glycemic Levels: Involvement of Hepatocyte Nuclear Factor-1alpha Expression and Activity. Endocrinology. 149, 717-724.

  23. Calado, J., Loeffler, J., Sakallioglu, O., Gok, F., Lhotta, K., Barata, J., and Rueff, J. (2006) Familial Renal Glucosuria: SLC5A2 Mutation Analysis and Evidence of Salt-Wasting. Kidney Int.. 69, 852-855.

  24. Calado, J., Soto, K., Clemente, C., Correia, P., and Rueff, J. (2004) Novel Compound Heterozygous Mutations in SLC5A2 are Responsible for Autosomal Recessive Renal Glucosuria. Hum. Genet.. 114, 314-316.

  25. van den Heuvel, L. P., Assink, K., Willemsen, M., and Monnens, L. (2002) Autosomal Recessive Renal Glucosuria Attributable to a Mutation in the Sodium Glucose Cotransporter (SGLT2). Hum. Genet.. 111, 544-547.