Phenotypic Mutation 'corpulent'

• Allele: corpulent
• Mutation Type: critical splice donor site
• Chromosome: 9
• Coordinate: 22,486,492 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Bbs9
• Gene Name: Bardet-Biedl syndrome 9
• Synonym(s): E130103I17Rik, EST 3159894
• Chromosomal Location: 22,387,011-22,799,576 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000043042 ^†] [ENSMUSP00000120927 ^†] [ENSMUSP00000122058 ^†] [ENSMUSP00000116629 ^†] † probably from a misspliced transcript
• AlphaFold: Q811G0
• SMART Domains: Protein: ENSMUSP00000043042; Gene: ENSMUSG00000035919

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	421	8e-168	PFAM
Pfam:PHTB1_C	439	814	8.3e-163	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000120927; Gene: ENSMUSG00000035919

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	417	1.1e-166	PFAM
Pfam:PHTB1_C	440	818	7e-158	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000120927; Gene: ENSMUSG00000035919

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	417	1.1e-166	PFAM
Pfam:PHTB1_C	440	818	7e-158	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000122058; Gene: ENSMUSG00000035919

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	421	8e-168	PFAM
Pfam:PHTB1_C	439	814	8.3e-163	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000116629; Gene: ENSMUSG00000035919

Domain	Start	End	E-Value	Type
Pfam:PHTB1_N	1	421	8e-168	PFAM
Pfam:PHTB1_C	439	814	8.3e-163	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9496
• Is this an essential gene?: Probably essential (E-score: 0.870)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:39 PM by Anne Murray
• Record Created: 2017-09-05 2:23 PM
• Record Posted: 2018-08-01
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Emre Turer, Zhao Zhang, Carol Wise, Jonathan Rios, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_178415, NM_181316; MGI:2442833

Alleles Listed at MGI

All Mutations and Alleles(18) : Gene trapped(16) Targeted(2)

Phenotypic Description

Figure 1. Corpulent mice exhibited increased body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Corpulent mice exhibited increased fat mass compared to wild-type littermates. Normalized data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Corpulent mice exhibited reduced lean fat ratios compared to wild-type littermates. Normalized data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Corpulent mice exhibited reduced pelivis lengths compared to wild-type littermates. Normalized data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Corpulent mice exhibited reduced tibia lengths compared to wild-type littermates. Normalized data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The corpulent phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5364, some of which showed increased body weights compared to wild-type littermates (Figure 1). Some mice also showed increased fat mass (Figure 2), reduced lean fat ratios (Figure 3), reduced pelvis lengths (Figure 4), and reduced tibia lengths (Figure 5).

Nature of Mutation

Figure 6. Linkage mapping of the increased fat mass phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 98 mutations (X-axis) identified in the G1 male of pedigree R5364. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 98 mutations. All of the above phenotypes were  linked to a mutation in Bbs9:  a G to T transversion at base pair 22,575,196 (v38) on chromosome 9, or base pair 99,660 in the GenBank genomic region NC_000075 within the splice donor site of intron 8. The strongest association was found with a recessive model of inheritance to the fat mass phenotype, wherein two variant homozygotes departed phenotypically from 20 homozygous reference mice and 23 heterozygous mice with a P value of 2.945 x 10^-21 (Figure 6).  A substantial semidominant effect was also observed (P = 3.348 x 10^-5). 

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation is predicted to result in the use of a cryptic splice site in exon 8. The resulting transcript would have a 78-base pair deletion in exon 8. The deletion would cause an in-frame deletion of 26 amino acids beginning after amino acid 209 of the protein, which is normally 880 amino acids long.

<--exon 7 exon 8-->                   intron 8-->        exon 9--> 1015 ……GAAAGTTACAA GTACCAGGTACTT……AAGCGGCTAGTT gtaagtctatacggct…… GTGGACTGGACT…… 1122 203  ……-E--S--Y--K --Y--Q--V--L-……-K--R--L--V-                    -V--D--W--T-…… 213               correct            deleted                             correct

The donor splice site of intron 8, which is destroyed by the corpulent mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 7. Domain structure of BBS9. BBS9 has an N-terminal β-propeller fold followed by an amphipathic helical linker, a γ-adaptin ear (GAE) β-sandwich domain, a mixed α/β platform domain, and an α-helical domain. The corpulent mutation occurs within the splice donor site of intron 8.

Figure 8. Crystal structure of the β-propeller region of human BBS9. The WD40 β-propeller has seven anti-parallel, four-stranded β-sheets arranged around a central pore. Image created in UCSF Chimera and based on PDBID 4YD8.

BBS9 (alternatively, PTHB1) has an N-terminal β-propeller fold, an amphipathic helical linker, a γ-adaptin ear (GAE) domain, a mixed α/β platform domain, and a C-terminal α-helical domain [Figure 7; (1;2)].

The BBS9 β-propeller fold is a WD40 β-propeller, which has seven anti-parallel, four-stranded β-sheets arranged around a central pore [Figure 8; PDB:4YD8; (2)]. The BBS9 β-propeller region is proposed to mediate protein-protein interactions with other BBS proteins.  

The GAE domain is approximately 120-amino acids, and functions in the recruitment of accessory proteins that modulate the functions of GAE domain-containing proteins in membrane trafficking. The GAE domain forms an immunoglobulin-like β-sandwich fold composed of eight β-strands and two short α-helices (3-5). The binding site for the accessory proteins is in a shallow hydrophobic trough surrounded by charged (mainly basic) residues (4;5). In clathrin adaptors, the GAE and platform domains are an appendage domain that recruits either regulators of coat assembly or factors that promote correct targeting of the coated vesicle (6).

The corpulent mutation is a splice site mutation that is predicted to result in an in-frame deletion of 26 amino acids after amino acid 209. The deletion is within the β-propeller region.

Expression/Localization

BBS9 is ubiquitously expressed. BBS9 is localized to nonmembranous centriolar satellites in the cytoplasm as well as to the membrane of the cilium (7).

Background

Figure 9. Model of the function of the BBSome. The BBSome organizes IFT-A, IFT-B and kinesin motors into a functional complex. Entry of protein cargo to the cilium is regulated by active forms of Rab8, a master modulator for the ciliary protein trafficking. Rab8 is recruited to the basal body of primary cilium. The activities of Rab8 are then regulated by Rabin8, and its activity and basal body localization is modulated by the BBSome and Rab11. IFT particles dissociate after reaching the ciliary tip, and then the BBSome and DYF-2 coordinate to reorganize the entire IFT complex to ready it for retrograde transport.

Almost every cell in the body carries a single primary cilium at a certain stage of its life cycle. Primary cilia are required for planar cell polarity, phototransduction, olfaction, adipocyte differentiation, and Hedgehog signaling.

Several events occur to facilitate transport of membrane proteins to the cilia: (i) sorting and packaging into carrier vesicles, (ii) docking and fusion of vesicles with the base of the cilium, and (iii) intraflagellar transport (IFT) from the cilia base to cilia tip. Rab8^GTP promotes the extension of the ciliary membrane as well as docking and fusion of the carrier vesicles with the base of the cilium (7). The Rab8^GTP localizes to the cilium whereby it promotes docking and fusion of vesicles to the base of the ciliary membrane. BBS9 is one of eight proteins (i.e., BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9, and BBIP10) that form the core of the Bardet-Biedl syndrome protein complex (BBSome) required for ciliogenesis [Figure 9; (7;8)]. The BBSome transports and sorts membrane proteins into the primary cilium and maintains the unique protein composition of the ciliary membrane. The BBSome  associates with the ciliary membrane and binds to the Rab8 guanosyl exchange factor RAB3IP/Rabin8 (7). The BBsome is proposed to direct vesicular trafficking to the cilium by promoting Rabin8-associated activation of Rab8 (7). The exact function of BBS9 within the BBSome is unknown, but it may promote proper BBSome assembly and/or its ciliary localization (7).

Mutations in BBS9 are linked to Bardet-Bidel syndrome-9 [OMIM: #615986; (9-11)]. Patients with Bardet-Bidel syndrome-9 exhibit obesity, polydactyly, renal anomalies, retinopathy, and mental retardation (10). The phenotypes observed in Bardet-Bidel syndrome are proposed to be due to defects in vesicular transport in the cilium. Mutations in BBS9 have also been associated with premature ovarian failure, which causes female infertility (12).

Bbs9-deficient mice have not been generated/phenotypically characterized (MGI; accessed October 23, 2017). However, knockdown of BBS9 in zebrafish resulted in retina and brain developmental defects that were rescued by expression of human BBS9 mRNA (13). Mutations in the other members of the BBSome result in similar phenotypes, including increased body weights/obesity, defects in social function, retinal degeneration, renal cysts, olfaction defects, and male infertility due to cilium dysfunction [Bbs1 (14;15); Bbs2 (16); Bbs4 (15;16); Bbs5 (MGI; accessed October 27, 2017); Bbs7 (17); Bbs8 (18); and Bbip1 (8)].

Putative Mechanism

Cilia-associated obesity is proposed to result from an altered initiation of the ciliary transport at the basal area of the cilium, resulting in changes in adipogenesis, central signaling of food intake, and/or odor perception. During adipogenesis, ciliary proteins have putative roles in maintaining the function of pro-adipogenic factors (e.g., insulin-like growth factor 1 receptor (IGF1-R), CAATT/enhancer binding protein α-β (CEBP/A-B) and PPARγ), while also promoting anti-adipogenic signaling pathways (e.g., SHH, Wnt, and Notch) (19). The cilium may also function in neuronal food intake regulation. Cilia of hypothalamic neurons contain receptors involved in food intake regulation, including orexigenic neuropeptide Y (see the record oleo for information about neuropeptide Y receptor [NPY5R]) (20) and melanin-concentrating hormone receptor 1 (Mchr1) (21). A reduction in the number of cilia or a change in length may induce hyperphagia and obesity. Hyposmia and anosmia (reduction or ablation of odor perception, respectively) may lead to weight loss, weight gain or no change in weight. Food odor can stimulate appetite, food-seeking behavior and food ingestion, but strong or prolonged exposure to a food odor can have a satiating effect (22). The phenotype of the corpulent mice indicates loss of BBS9^corpulent function.

Primers

PCR Primer
corpulent_pcr_F: CACAGCATTTATGGACTGTGTAC
corpulent_pcr_R: TTCAATGAAAAGTGGTGCCAC

Sequencing Primer
corpulent_seq_F: CTTGCCTTTGCCACAGAT
corpulent_seq_R: GCCATTTACAGTTGCAGCACG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 410 nucleotides is amplified (chromosome 9, + strand):

1   cacagcattt atggactgtg tacctttaaa gtttaaagtg atttttactt taaaacttat
61  gatgtcactt atcctttgcc atctcttcaa acaggtacca ggtacttgcc tttgccacag
121 atgcagacaa gaagcaggag atggaacagc aaaaacttgg ttctggaaag cggctagttg
181 taagtctata cggctcagga acgctactca tggtcacagt tgtagagaat tcctggaaga
241 aaattaaaaa tgtattttga caatttctct ttatccgctg tacaatgacc agggattgaa
301 ttgcctgttg ctgtgctgta gatcatgtct gtccacatgc cgaaatgcat cagaatacag
361 cgtggcgtgc tgcaactgta aatggctggg tggcaccact tttcattgaa 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Jin, H., White, S. R., Shida, T., Schulz, S., Aguiar, M., Gygi, S. P., Bazan, J. F., and Nachury, M. V. (2010) The Conserved Bardet-Biedl Syndrome Proteins Assemble a Coat that Traffics Membrane Proteins to Cilia. Cell. 141, 1208-1219.

  2. Knockenhauer, K. E., and Schwartz, T. U. (2015) Structural Characterization of Bardet-Biedl Syndrome 9 Protein (BBS9). J Biol Chem. 290, 19569-19583.

  3. Hirst, J., Lui, W. W., Bright, N. A., Totty, N., Seaman, M. N., and Robinson, M. S. (2000) A Family of Proteins with Gamma-Adaptin and VHS Domains that Facilitate Trafficking between the Trans-Golgi Network and the vacuole/lysosome. J Cell Biol. 149, 67-80.

  4. Nogi, T., Shiba, Y., Kawasaki, M., Shiba, T., Matsugaki, N., Igarashi, N., Suzuki, M., Kato, R., Takatsu, H., Nakayama, K., and Wakatsuki, S. (2002) Structural Basis for the Accessory Protein Recruitment by the Gamma-Adaptin Ear Domain. Nat Struct Biol. 9, 527-531.

  5. Kent, H. M., McMahon, H. T., Evans, P. R., Benmerah, A., and Owen, D. J. (2002) Gamma-Adaptin Appendage Domain: Structure and Binding Site for Eps15 and Gamma-Synergin. Structure. 10, 1139-1148.

  6. McMahon, H. T., and Mills, I. G. (2004) COP and Clathrin-Coated Vesicle Budding: Different Pathways, Common Approaches. Curr Opin Cell Biol. 16, 379-391.

  7. Nachury, M. V., Loktev, A. V., Zhang, Q., Westlake, C. J., Peranen, J., Merdes, A., Slusarski, D. C., Scheller, R. H., Bazan, J. F., Sheffield, V. C., and Jackson, P. K. (2007) A Core Complex of BBS Proteins Cooperates with the GTPase Rab8 to Promote Ciliary Membrane Biogenesis. Cell. 129, 1201-1213.

  8. Loktev, A. V., Zhang, Q., Beck, J. S., Searby, C. C., Scheetz, T. E., Bazan, J. F., Slusarski, D. C., Sheffield, V. C., Jackson, P. K., and Nachury, M. V. (2008) A BBSome Subunit Links Ciliogenesis, Microtubule Stability, and Acetylation. Dev Cell. 15, 854-865.

  9. Nishimura, D. Y., Swiderski, R. E., Searby, C. C., Berg, E. M., Ferguson, A. L., Hennekam, R., Merin, S., Weleber, R. G., Biesecker, L. G., Stone, E. M., and Sheffield, V. C. (2005) Comparative Genomics and Gene Expression Analysis Identifies BBS9, a New Bardet-Biedl Syndrome Gene. Am J Hum Genet. 77, 1021-1033.

  10. Abu-Safieh, L., Al-Anazi, S., Al-Abdi, L., Hashem, M., Alkuraya, H., Alamr, M., Sirelkhatim, M. O., Al-Hassnan, Z., Alkuraya, B., Mohamed, J. Y., Al-Salem, A., Alrashed, M., Faqeih, E., Softah, A., Al-Hashem, A., Wali, S., Rahbeeni, Z., Alsayed, M., Khan, A. O., Al-Gazali, L., Taschner, P. E., Al-Hazzaa, S., and Alkuraya, F. S. (2012) In Search of Triallelism in Bardet-Biedl Syndrome. Eur J Hum Genet. 20, 420-427.

  11. Khan, M. A., Mohan, S., Zubair, M., and Windpassinger, C. (2016) Homozygosity Mapping Identified a Novel Protein Truncating Mutation (p.Ser100Leufs*24) of the BBS9 Gene in a Consanguineous Pakistani Family with Bardet Biedl Syndrome. BMC Med Genet. 17, 10-016-0271-9.

  12. Kang, H., Lee, S. K., Kim, M. H., Song, J., Bae, S. J., Kim, N. K., Lee, S. H., and Kwack, K. (2008) Parathyroid Hormone-Responsive B1 Gene is Associated with Premature Ovarian Failure. Hum Reprod. 23, 1457-1465.

  13. Veleri, S., Bishop, K., Dalle Nogare, D. E., English, M. A., Foskett, T. J., Chitnis, A., Sood, R., Liu, P., and Swaroop, A. (2012) Knockdown of Bardet-Biedl Syndrome Gene BBS9/PTHB1 Leads to Cilia Defects. PLoS One. 7, e34389.

  14. Davis, R. E., Swiderski, R. E., Rahmouni, K., Nishimura, D. Y., Mullins, R. F., Agassandian, K., Philp, A. R., Searby, C. C., Andrews, M. P., Thompson, S., Berry, C. J., Thedens, D. R., Yang, B., Weiss, R. M., Cassell, M. D., Stone, E. M., and Sheffield, V. C. (2007) A Knockin Mouse Model of the Bardet-Biedl Syndrome 1 M390R Mutation has Cilia Defects, Ventriculomegaly, Retinopathy, and Obesity. Proc Natl Acad Sci U S A. 104, 19422-19427.

  15. Kulaga, H. M., Leitch, C. C., Eichers, E. R., Badano, J. L., Lesemann, A., Hoskins, B. E., Lupski, J. R., Beales, P. L., Reed, R. R., and Katsanis, N. (2004) Loss of BBS Proteins Causes Anosmia in Humans and Defects in Olfactory Cilia Structure and Function in the Mouse. Nat Genet. 36, 994-998.

  16. Nishimura, D. Y., Fath, M., Mullins, R. F., Searby, C., Andrews, M., Davis, R., Andorf, J. L., Mykytyn, K., Swiderski, R. E., Yang, B., Carmi, R., Stone, E. M., and Sheffield, V. C. (2004) Bbs2-Null Mice have Neurosensory Deficits, a Defect in Social Dominance, and Retinopathy Associated with Mislocalization of Rhodopsin. Proc Natl Acad Sci U S A. 101, 16588-16593.

  17. Zhang, Q., Nishimura, D., Vogel, T., Shao, J., Swiderski, R., Yin, T., Searby, C., Carter, C. S., Kim, G., Bugge, K., Stone, E. M., and Sheffield, V. C. (2013) BBS7 is Required for BBSome Formation and its Absence in Mice Results in Bardet-Biedl Syndrome Phenotypes and Selective Abnormalities in Membrane Protein Trafficking. J Cell Sci. 126, 2372-2380.

  18. Tadenev, A. L., Kulaga, H. M., May-Simera, H. L., Kelley, M. W., Katsanis, N., and Reed, R. R. (2011) Loss of Bardet-Biedl Syndrome Protein-8 (BBS8) Perturbs Olfactory Function, Protein Localization, and Axon Targeting. Proc Natl Acad Sci U S A. 108, 10320-10325.

  19. Marion, V., Mockel, A., De Melo, C., Obringer, C., Claussmann, A., Simon, A., Messaddeq, N., Durand, M., Dupuis, L., Loeffler, J. P., King, P., Mutter-Schmidt, C., Petrovsky, N., Stoetzel, C., and Dollfus, H. (2012) BBS-Induced Ciliary Defect Enhances Adipogenesis, Causing Paradoxical Higher-Insulin Sensitivity, Glucose Usage, and Decreased Inflammatory Response. Cell Metab. 16, 363-377.

  20. Loktev, A. V., and Jackson, P. K. (2013) Neuropeptide Y Family Receptors Traffic Via the Bardet-Biedl Syndrome Pathway to Signal in Neuronal Primary Cilia. Cell Rep. 5, 1316-1329.

  21. Berbari, N. F., Lewis, J. S., Bishop, G. A., Askwith, C. C., and Mykytyn, K. (2008) Bardet-Biedl Syndrome Proteins are Required for the Localization of G Protein-Coupled Receptors to Primary Cilia. Proc Natl Acad Sci U S A. 105, 4242-4246.

  22. Lushchak, O. V., Carlsson, M. A., and Nassel, D. R. (2015) Food Odors Trigger an Endocrine Response that Affects Food Ingestion and Metabolism. Cell Mol Life Sci. 72, 3143-3155.