Phenotypic Mutation 'kookaburra' (pdf version)
List |< first << previous [record 56 of 132] next >> last >|
Allelekookaburra
Mutation Type nonsense
Chromosome3
Coordinate135,626,611 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Nfkb1
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonym(s) p50 subunit of NF kappaB, nuclear factor kappaB p50, NF-kappaB, NF-kappaB p50, p50, p50/p105, NF kappaB1
Chromosomal Location 135,584,655-135,691,547 bp (-)
MGI Phenotype Strain: 1857225
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008689; MGI:97312

Mapped Yes 
Amino Acid Change Lysine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000029812] [ENSMUSP00000128345] [ENSMUSP00000143601]
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: K128*

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: K128*

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - decreased
FACS CD44+ CD8 MFI - increased
FACS central memory CD4 T cells in CD4 T cells - decreased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
total IgE after 2nd OVA/Alum - decreased
Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased 7834752
total IgE level - decreased 7834752
Penetrance  
Alleles Listed at MGI

All alleles(83) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(74) Radiation induced(1) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135590839 missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135594981 missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135601467 missense probably benign
IGL02216:Nfkb1 APN 3 135594963 missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135605207 missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135590818 missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135618830 missense possibly damaging 0.48
Finlay UTSW 3 135595053 nonsense probably null
Murgatroyd UTSW 3 135626710 missense
puff UTSW 3 135595053 nonsense
Roomba UTSW 3 135612412 critical splice donor site probably null
R0026:Nfkb1 UTSW 3 135591573 missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135595053 nonsense probably null
R0989:Nfkb1 UTSW 3 135589396 missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135594927 missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135594957 missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135667758 missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135615349 missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135601479 missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135601521 missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135613943 missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135589329 missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135594349 missense possibly damaging 0.63
R4232:Nfkb1 UTSW 3 135603770 missense probably damaging 1.00
R4936:Nfkb1 UTSW 3 135613982 missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135603807 missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135612412 critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135612542 missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135626611 nonsense probably null
R5663:Nfkb1 UTSW 3 135603851 missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135603780 missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135603761 nonsense probably null
R6013:Nfkb1 UTSW 3 135626684 missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135626710 missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135615303 missense probably benign
X0050:Nfkb1 UTSW 3 135606623 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-07-20 12:11 PM by Diantha La Vine
Record Created 2017-09-09 4:17 PM by Bruce Beutler
Record Posted 2017-09-15
Phenotypic Description

Figure 1. Kookaburra mice exhibit decreased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Kookaburra mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Kookaburra mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Kookaburra mice exhibit increased CD44 expression on peripheral blood CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Kookaburra mice exhibited decreased serum levels of total IgE. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The kookaburra phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5434, some of which showed reduced frequencies of central memory CD4 T cells in CD4 T cells (Figure 1) and naive CD8 T cells in CD8 T cells (Figure 2) with concomitant increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 3), all in the peripheral blood. Expression of CD44 on peripheral blood CD8 T cells was increased (Figure 4). The serum levels of total IgE were also reduced (Figure 5).

Nature of Mutation
Figure 6. Linkage mapping of the increased central memory CD8 T cells in CD8 T cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R5434. Normalized data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Nfkb1: an A to T transversion at base pair 135,626,611 (v38) on chromosome 3, corresponding to base pair 65,372 in the GenBank genomic region NC_000069 encoding Nfkb1. The strongest association was found with a recessive model of inheritance to the normalized frequency of central memory CD8 T cells in CD8 T cells, wherein five variant homozygotes departed phenotypically from 16 homozygous reference mice and 35 heterozygous mice with a P value of 7.573 x 10-16 (Figure 6).

 

The mutation corresponds to residue 884 in the mRNA sequence NM_178666 within exon 7 of 25 total exons.

 

869 GTAACAGCAGGACCCAAGGACATGGTGGTTGGC

123 -V--T--A--G--P--K--D--M--V--V--G-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of lysine 128 for a premature stop codon (K128*) in the NF-κB1 protein.

Protein Prediction
Figure 7. The NF-κB and IκB families. The nuclear-κB family consists of five members: REL (c-Rel), RelA (p65), RelB, p105/p50 (NF-κB1), and p100/p52 (NF-κB2; see the record for xander).  They share a conserved N-terminal Rel-homology domain (RHD), which contains the dimerization, nuclear translocation, and DNA binding motifs. c-Rel, RelA, and RelB also have non-homologous C-terminal transactivation domains, and RelB contains an additional leucine zipper (shown in orange). These factors dimerized in various combinations to form NF-κB transcription factor complexes. The inhibitor of NF-κB (IκB) family contains the classical IκBs (IκBαIκBβ, and IκBε), the NF-κB precursors (p105 and p100), as well as B-cell lymphoma 3 (BCL-3), IκBζ, and IκBNS. These proteins are characterized by an ankyrin domain that contains five to seven ankyrin repeats and are able to bind to and inhibit the NF-κB RHDs. Exceptions are BCL-3 and IκBζ, which are able to bind p50 and p52 homodimers and induce transcription. Cleavage of p105 and p100 generates the p50 and p52 NF-κB, respectively. p105 also generates IκBγ (not shown).
Figure 8. Domain organization of NF-κB1. The p105 precursor and p50 are both shown. The protein has an N-terminal Rel homology domain (RHD), a glycine rich region (GRR), an ankyrin repeat domain (ARD), a death domain (DD), and a PEST motif. The location of the kookaburra mutation is indicated in red. The image is interactive; click to view additional mutations in Nfkb1.

NF-κB1 (alternatively, p50/p105) is a member of the NF-κB protein family that are characterized by an N-terminal Rel homology domain (RHD), a glycine rich region (GRR), an ankyrin repeat domain (ARD), a death domain (DD), and a PEST motif [Figure 7 & 8; reviewed in (1)]. The p105 precursor protein can be proteolytically processed to generate p50 (i.e., amino acids 1-430 of p105). The RHD (amino acids 42-240, SMART) is comprised of the N-terminal domain, the dimerization domain (DimD), and a nuclear localization sequence that mediate DNA binding, nuclear localization, and subunit dimerization [reviewed in (1)]. The p50 RHD mediates co-translational dimerization with p105 and this dimerization is necessary for efficient p50 production (2;3). The GRR (amino acids 400-475 (4); 370-392, UniProt) is essential for the constitutive processing of p105 to p50 as well as for stabilization of the p50 subunit (2;5;6). Cohen et al. described a processing inhibitory domain (PID; aa 474-544) downstream of the GRR and upstream of the ARD that functions to regulate the constitutive processing of p105 (7). The ARD is at the C-terminus of p105 (amino acids 507-743, SMART) and has seven ankyrin motifs [reviewed in (1)]. The DD of p105 (aa 801-888, UniProt) is essential for IKK1 and IKK2-mediated phosphorylation of the p105 PEST motif by acting as a docking site for IKK (8;9). The PEST motif contains a conserved motif (Asp-Ser927-Gly-Val-Gly-Thr-Ser932) homologous to the IKK target sequence in IκBα [reviewed in (10)]. The kookaburra mutation results in substitution of lysine 128 for a premature stop codon (K128*) in the NF-κB1 protein; residue 128 is within the RHD.

 

For more information about Nfkb1, please see the record for Finlay.

Putative Mechanism

NF-κB1 (p50 and p105) can form homodimers or heterodimers with c-Rel, RelA (p65), NF-κB2 (p52 and its precursor p100; see the record for xander), or RelB (11). The p105 precursor can act as an inhibitor of NF-κB dimers through both a direct dimerization to the NF-κB polypeptides as well as through interactions with preformed dimers (12). After agonist stimulation, p105 is degraded, facilitating the release of associated Rel subunits (i.e., RelA, c-Rel, and p50) and the translocation of the Rel subunits from the cytoplasm into the nucleus; RelB is not retained in the cytoplasm by p105 (13-16). In addition, p105 and IκBγ can associate with NF-κB dimers and prevent them from translocating to the nucleus (17). The p50 homodimer can bind to both nucleosomal DNA as well as naked DNA, facilitating the regulation of genes at sites of transcriptionally repressed chromatin as well as genes found in transcriptionally active chromatin (18). Depending on the cell type, the p50 homodimer can act as either a transcriptional activator or a repressor [reviewed in (10)]. The p50 homodimer typically binds DNA in unstimulated cells to repress NF-κB-dependent gene transcription (19). After stimulation, p50 homodimers can also function as transcriptional activators by an association of the homodimer with transcriptional co-activators.

 

A variety of stimuli (e.g., cytokines, ultraviolet irradiation, and viral products) activate NF-κB complexes and the translocation of the activated complexes to the nucleus. In the nucleus, NF-κB acts as a transcription factor that regulates the expression of genes encoding a variety of immune response genes including pro-inflammatory cytokines (e.g., TNFα (see the record for PanR1), IL-1, and IL-6), chemokines [e.g., MIP-1α (macrophage inflammatory protein-1α) and RANTES (regulated upon activation, normal T-cell expressed and secreted)], cell adhesion molecules [e.g., E-selectin and VCAM-1 (vascular cell adhesion molecule-1)], effector molecules [e.g., defensins], enzymes [e.g., inducible nitric oxide synthase], and growth factors to regulate the recruitment of immune cells to the site of infection [(20;21); reviewed in (10)]. Inhibition of NF-κB leads to apoptosis [through the misregulation of anti-apoptotic proteins (e.g., c-IAP-1/2, AI, Bcl-2 and Bcl-XL)], delayed cell growth, reduced cell proliferation [through negative regulation of cell cycle regulator cyclin D1 (22)] and incorrect immune cell development [reviewed in (23-25)]. Please see the record for xander for additional details about NF-κB signaling.

  

The phenotypes observed in the kookaburra mice indicate loss of NF-κB1kookaburra function.

Primers PCR Primer
kookaburra(F):5'- TTGTCTCAGGCAGGACAGATATC -3'
kookaburra(R):5'- TCCATGTTACAGTCAGGTCAGATG -3'

Sequencing Primer
kookaburra_seq(F):5'- CTCTATTTCCTTAGCAGTTCAAAGG -3'
kookaburra_seq(R):5'- ACAGTCAGGTCAGATGTACTAAC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler
List |< first << previous [record 56 of 132] next >> last >|