Phenotypic Mutation 'bella' (pdf version)
Allelebella
Mutation Type missense
Chromosome13
Coordinate94,528,257 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Ap3b1
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonym(s) recombination induced mutation 2, rim2, Hps2, beta3A, AP-3
Chromosomal Location 94,358,960-94,566,317 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_009680; MGI:1333879

MappedYes 
Amino Acid Change Arginine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022196]
AlphaFold Q9Z1T1
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: R901S

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Predicted Effect unknown
Predicted Effect unknown
Meta Mutation Damage Score 0.9138 question?
Is this an essential gene? Possibly nonessential (E-score: 0.395) question?
Phenotypic Category
Phenotype question? Literature verified References
pigmentation 6279728
skin/coat/nails 6279728
Candidate Explorer Status CE: excellent candidate; Verification probability: 0.488; ML prob: 0.476; human score: 0
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(54) : Chemically induced (ENU)(1) Chemically induced (other)(1) Gene trapped(34) Spontaneous(14) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bullet_gray UTSW 13 94451087 critical splice donor site probably benign
slug UTSW 13 94408845 critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0346:Ap3b1 UTSW 13 94445971 nonsense probably null
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94528158 splice site probably null
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R8492:Ap3b1 UTSW 13 94394786 missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94408845 critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94528217 missense unknown
R8876:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94542840 missense unknown
R8892:Ap3b1 UTSW 13 94542840 missense unknown
R9065:Ap3b1 UTSW 13 94471715 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 2021-11-22 7:44 AM by Diantha La Vine
Record Created 2017-10-03 1:40 PM by Carlos Reyna
Record Posted 2018-02-22
Phenotypic Description
Figure 1. Bella mice (left) exhibit hypopigmentation. A wild-type (C57BL/6J) littermate is shown for comparison (right). 

The bella phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5671, some of which showed brown fur (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hypopigmenation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R5671. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. The pigmentation phenotype was linked to a mutation in Ap3b1: an A to T transversion at base pair 94,528,257 (v38) on chromosome 13, or base pair 169,678 in the GenBank genomic region NC_000079 encoding Ap3b1. Linkage was found with a recessive model of inheritance (P = 0.000448), wherein three affected mice were homozygous for the variant allele, and 26 unaffected mice were either heterozygous (N = 17) or homozygous for the reference allele (N = 9) (Figure 2).  

 

The mutation corresponds to residue 2,847 in the mRNA sequence NM_009680 within exon 23 of 27 total exons.

 

2830 CACTACTGCTTCCCAAGACAGCCCTGCATCTTC
986  -H--Y--C--F--P--R--Q--P--C--I--F-

 

The mutated nucleotide is indicated in red. The mutation results in an arginine to serine substitution at position 901 (R901S) in the AP3B1 protein.

Illustration of Mutations in
Gene & Protein
Protein Prediction

AP-3 is one of four different heterotetrameric adaptor protein complexes (AP-1 to AP-4) in mammalian cells that decorate the cytoplasmic surface of membrane-bound vesicles at all levels from the trans-Golgi complex to the plasma membrane and direct subcelluar trafficking of membrane cargo proteins (1). The AP-1 and AP-2 complexes have an overall shape reminiscent of a “head” with two protruding “ears” separated by a hinge region, and it is believed that AP-3 has the same general shape (2-4). The A (“amino terminal” or "head") region (alternatively, the trunk domain) contains 12-13 Armadillo repeats, known to function in other settings as protein-protein interaction domains (5).  The H (“hinge”) region is strongly hydrophilic and rich in serine and acidic residues, and the C (“carboxy terminal”) region corresponds to an “ear” of the holoprotein complex.  The bella mutation results in an arginine to serine substitution at position 901 (R901S) in the AP3B1 protein; residue 901 is within the C region.

 

For more information about Ap3b1, please see the record for bullet_gray.

Putative Mechanism

Mutations in the β3A subunit of the AP-3 complex cause Hermansky-Pudlak syndrome-2 (HPS-2; OMIM #608233) (6-10). Oculocutaneous albinism (OCA) and prolonged bleeding due to impaired platelet aggregation are common to all forms of HPS, but additional manifestations characterize specific types of HPS, such as pulmonary fibrosis (HPS-1 and HPS-4), and neutropenia and mild immunodeficiency (HPS-2).

 

The AP complexes transport cargo proteins between components of the endocytic pathway, and AP-3 specifically shuttles proteins from the TGN to lysosomes and lysosome-related organelles (11;12).  Incorrect targeting of AP-3 protein cargo, such as the melanin-biosynthetic enzyme tyrosinase (mutated in ghost) to melanosomes, would account for the hypopigmentation of bullet gray animals.

Primers PCR Primer
bella_pcr_F: ACACATGTCCTGAGTATTGGCTTG
bella_pcr_R: GGGCACTCTCAGTTAGTAAATAATGC

Sequencing Primer
bella_seq_F: CTTGTTTTCTAGAAGCAGTAGTGAC
bella_seq_R: AAACATTTAGGAACCAAGTTTGCAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

 

The following sequence of 426 nucleotides is amplified (chromosome 13, + strand):

 

 

1   acacatgtcc tgagtattgg cttgttttct agaagcagta gtgactgaat gtcctcacta
61  actcctgtcg tcctcccaca tgcccaggtc agtacgcctg tcttcgtgcc aacaaaaaca
121 catgagctgc ttcaccgaat gcatgggaaa ggactggccg cccactactg cttcccaaga
181 cagccctgca tcttcagtga caagatggtc tctgtacaga tcaccctgac taatacttct
241 gatcgaaaaa tagaaaacat ccacataggg gggaaagggc ttcctgtggg catgcagatg
301 catgcctttc atccaatagg taaaggctaa gtcttactgc aaacttggtt cctaaatgtt
361 ttcactttta aagcagagtt tcagaaaaag ataaaataca gcattattta ctaactgaga
421 gtgccc

 

 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsCarlos Reyna, Jamie Russell, and Bruce Beutler