Phenotypic Mutation 'dreary'

• Allele: dreary
• Mutation Type: critical splice acceptor site
• Chromosome: 11
• Coordinate: 71,004,466 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Nlrp1a
• Gene Name: NLR family, pyrin domain containing 1A
• Synonym(s): Nalp1
• Chromosomal Location: 70,983,062-71,035,530 bp (-) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000038186] [ENSMUSP00000104158 ^†] † probably from a misspliced transcript
• AlphaFold: Q2LKU9
• SMART Domains: Protein: ENSMUSP00000038186; Gene: ENSMUSG00000069830; AA Change: R721G

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Pfam:NACHT	133	302	4.6e-41	PFAM
low complexity region	482	494	N/A	INTRINSIC
LRR	632	659	4.53e-1	SMART
LRR	742	769	3.04e-5	SMART
low complexity region	856	870	N/A	INTRINSIC
Pfam:FIIND	921	1173	1.6e-102	PFAM
Pfam:CARD	1209	1292	2.3e-20	PFAM

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
  (Using ENSMUST00000048514)
• SMART Domains: Protein: ENSMUSP00000104158; Gene: ENSMUSG00000069830

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Pfam:NACHT	133	302	1.1e-40	PFAM
low complexity region	482	494	N/A	INTRINSIC
LRR	632	659	4.53e-1	SMART
LRR	661	688	2.85e1	SMART
LRR	689	716	3.04e-5	SMART
Pfam:FIIND	819	1073	3e-136	PFAM
Pfam:CARD	1091	1174	8.2e-20	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9505
• Is this an essential gene?: Probably nonessential (E-score: 0.084)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2019-09-04 9:38 PM by Anne Murray
• Record Created: 2017-11-08 10:10 AM by Bruce Beutler
• Record Posted: 2018-07-27
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001004142; MGI:2684861

Alleles Listed at MGI

All Mutations and Alleles(6) : Chemically induced (ENU)(1) Chemically induced (other)(1) Targeted(4)

Phenotypic Description

Figure 1. Dreary mice exhibit decreased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Dreary mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Dreary mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Dreary mice exhibit decreased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Dreary mice exhibit increased frequencies of peripheral CD8a+ dendritic cells (DCs) in CD11c+ cells . Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Dreary mice exhibit increased frequencies of peripheral neutrophils . Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Dreary mice exhibited fasting hypoglycemia. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Dreary mice exhibited increased rates of LPS-induced necroptosis of macrophages . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Dreary mice exhibited decreased IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by flagellin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The dreary phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4740, some of which showed reduced B to T cell ratios (Figure 1) due to reduced frequencies of B cells (Figure 2) and IgM+ B cells (Figure 3) in the peripheral blood. The dreary mice also showed reduced frequencies of NK cells (Figure 4) with concomitant increased frequencies of CD8a+ dendritic cells (DCs) in CD11c+ cells (Figure 5) and neutrophils (Figure 6) in the peripheral blood. Some mice showed fasting hypoglycemia (Figure 7) and an increased rate of LPS-induced necroptosis of macrophages (Figure 8). Some mice also exhibited impaired peritoneal macrophage NLRC4 inflammasome responses, marked by decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with flagellin (Figure 9).

Nature of Mutation

Figure 10. Linkage mapping of the reduced B cell frequency phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R4740. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. All of the above phenotypes were linked by continuous variable mapping to mutations in two genes on chromosome 11: Dnah2 and Nlrp1a. The mutation in Nlrp1a was presumed causative, and is an A to G transition at base pair 71,113,640 (v38) on chromosome 11, or base pair 31,334 in the GenBank genomic region NC_000077 within the acceptor splice site of intron 4.  The strongest association was found with a recessive model of inheritance to the B cell frequency phenotype, wherein three homozygous variant mice departed phenotypically from six homozygous reference mice and nine heterozygous mice with a P value of 8.385 x 10^-7 (Figure 10).   

The effect of the mutation at the cDNA and protein levels has not been examined, but the mutation may result in skipping of the 171-base pair exon 5 (out of 14 total exons). Exon 5 encodes amino acids 669 to 725.

<--exon 4      <--intron 4 exon 5-->                  exon 6--> 2211 ……AAGACTCTGTG ……catctcccatgcag GCTTGTTGAATGC……AGCATCCTGTG GCTGGACCAGGCA…… 2405 665  ……-K--T--L--W                  --L--V--E--C-……-S--I--L--W --L--D--Q--A-……          correct                              deleted             correct

The acceptor splice site of intron 4, which is destroyed by the dreary mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 11. Domain structure of the NLRP1A protein. The dreary mutation destroys the acceptor splice site of intron 4. The image is interactive. Click each mutation to view more information. 

'NLRP1A (alternatively, Nalp1, Nalp1a, NLRP1 [in humans]) is a member of the nucleotide-binding domain (NBD) and leucine-rich repeat (LRR) (NLR) family (1-4). Nlrp1a is one of three NLRP1 paralogs in the mouse: Nlrp1a, Nlrp1b, and Nlrp1c. The Nlrp1 paralogs are arranged in tandem on chromosome 11. NLRP1A and NLRP1B contain domains characteristic of mouse NLRs; however, NLRP1C is truncated and lacks the CARD domain. The three proteins share over 70% homology.

Similar to other NLRs, NLRP1A has several domains including, a central oligomerization NACHT domain, a leucine-rich repeat (LRR) region, a FIIND (function to find) domain (alternatively, ZU5 and UPA domains) and a CARD (caspase recruitment) domains (Figure 11). Rodent NLRP1 paralogs have a region termed NR100; the NR100 region has little homology to domains of other NLRs. The NR100 region is predicted to confer the rodent-specific sensitivity to Bacillus anthracis lethal toxin (5). The NR100 is cleaved by lethal toxin, leading to toxin-mediated inflammasome activation (5). In mouse NLRP1B, the FIIND domain confers intra-proteolytic activity, causing cleavage of the NLRP1B protein. Autoproteolysis is required, but not sufficient, for NLRP1B inflammasome activation in response to anthrax lethal toxin (6;7).The CARD domain of NLRP1A mediates the specificity of NLRP1A protein-protein interactions with other CARD-containing proteins (e.g., caspase-1) to facilitate assembly into complexes (8).

Please see the record watermelon for more information about Nlrp1a.

Putative Mechanism

Certain members of the NLR family, including NLRP1A, NLRP1B, NLRP3 (see the record for ND1), and NLRC4 (see the record for inwood) are able to oligomerize through their NBD domains and assemble into large caspase-1-activating multiprotein complexes termed inflammasomes upon the detection of pathogenic or other danger signals in the cytoplasm. The CARD domain of procaspase-1 recruits the protease to the inflammasome where it undergoes autoproteolytic maturation into its active form. Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes in by activating key processes such as the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK) pathways. NLRP1 primarily functions in caspase-1 and -5 activation, which subsequently activate L-1β and IL-18, as well as cause apoptosis. The NLRP1 inflammasome is activated by various stimuli, including Bacillus anthracis lethal toxin (only known rodent NLRP1B activator; does not activate human NLRP1 inflammasome) (9), Toxoplasma gondii (10;11), and host intracellular ATP depletion (12). The activator of the mouse NLRP1A inflammasome is unknown.

Mutations in NLRP1 are linked to autoinflammation with arthritis and dyskeratosis (AIADK; OMIM: #617388; (13)), multiple self-healing palmoplantar carcinoma (MSPC; OMIM: #615255; (14;15)), and susceptibility to vitiligo-associated multiple autoimmune disease (OMIM: #606579; (16)). Patients with AIADK exhibit recurrent fevers, widespread skin dyskeratosis, arthritis, elevated biologic markers of inflammation, and mild autoimmunity (13). Patients with MSPC exhibit recurrent keratoacanthomas in palmoplantar skin as well as in conjunctival and corneal epithelia (15). Patients also experience a high susceptibility to malignant squamous cell carcinoma (15). Vitiligo is an autoimmune disease characterized by melanocyte loss, which results in patchy depigmentation of skin and hair, and is associated with an elevated risk of other autoimmune diseases. 

Homozygous mice expressing an ENU-induced Nlrp1a-induced mutation (Q593P) exhibit premature death by 3 to 5 months of age (17). The Nlrp1a^Q593P/Q593P mice exhibit increased numbers of neutrophils with concomitant reduced numbers of lymphocytes and macrophages (17). The Nlrp1a^Q593P/Q593P spleen is enlarged and several organs exhibit neutrophilic inflammatory disease (e.g., myocarditis, inflammatory bowel disease, pancreas inflammation, meningitis, liver inflammation, and pneumonitis) (17).

The dreary phenotype indicates loss of NLRP1A^dreary function.

Primers

PCR Primer
dreary_pcr_F: ATCTCAGGGCTTGCTTACCAC
dreary_pcr_R: CAATGGCAGCAGAACATTGGTC

Sequencing Primer
dreary_seq_F: CTTACCACAGGATGCTGAGATTGC
dreary_seq_R: GGCAGCAGAACATTGGTCCTAAC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 11, - strand):

1   caatggcagc agaacattgg tcctaaccct atatccattg ctcctgcagc tcagctgtgg
61  agagcttgga attctctgcc tagaccaaaa aaggcacaac agagacctaa ccactggcag
121 cttagcatgc caaggctcac aaagggagac ctgagataag ttttcaaaag caatgagccc
181 tggataagct gacagtgagc atctcccatg caggcttgtt gaatgcggcc tcacatccac
241 atactgctca cttctggcct cagtactcag tgcccgctcc agcctgactg agctagacct
301 gcagctgaat gacctgggtg atggtggtgt gaagatgttg tgtgaggggc tcaggaatcc
361 tgcctgcaat ctcagcatcc tgtggtaagc aagccctgag at

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Damiano, J. S., Stehlik, C., Pio, F., Godzik, A., and Reed, J. C. (2001) CLAN, a Novel Human CED-4-Like Gene. Genomics. 75, 77-83.

  2. Geddes, B. J., Wang, L., Huang, W. J., Lavellee, M., Manji, G. A., Brown, M., Jurman, M., Cao, J., Morgenstern, J., Merriam, S., Glucksmann, M. A., DiStefano, P. S., and Bertin, J. (2001) Human CARD12 is a Novel CED4/Apaf-1 Family Member that Induces Apoptosis. Biochem Biophys Res Commun. 284, 77-82.

  3. Poyet, J. L., Srinivasula, S. M., Tnani, M., Razmara, M., Fernandes-Alnemri, T., and Alnemri, E. S. (2001) Identification of Ipaf, a Human Caspase-1-Activating Protein Related to Apaf-1. J Biol Chem. 276, 28309-28313.

  4. Ting, J. P., Lovering, R. C., Alnemri, E. S., Bertin, J., Boss, J. M., Davis, B. K., Flavell, R. A., Girardin, S. E., Godzik, A., Harton, J. A., Hoffman, H. M., Hugot, J. P., Inohara, N., Mackenzie, A., Maltais, L. J., Nunez, G., Ogura, Y., Otten, L. A., Philpott, D., Reed, J. C., Reith, W., Schreiber, S., Steimle, V., and Ward, P. A. (2008) The NLR Gene Family: A Standard Nomenclature. Immunity. 28, 285-287.

  5. Levinsohn, J. L., Newman, Z. L., Hellmich, K. A., Fattah, R., Getz, M. A., Liu, S., Sastalla, I., Leppla, S. H., and Moayeri, M. (2012) Anthrax Lethal Factor Cleavage of Nlrp1 is Required for Activation of the Inflammasome. PLoS Pathog. 8, e1002638.

  6. Frew, B. C., Joag, V. R., and Mogridge, J. (2012) Proteolytic Processing of Nlrp1b is Required for Inflammasome Activity. PLoS Pathog. 8, e1002659.

  7. D'Osualdo, A., Weichenberger, C. X., Wagner, R. N., Godzik, A., Wooley, J., and Reed, J. C. (2011) CARD8 and NLRP1 Undergo Autoproteolytic Processing through a ZU5-Like Domain. PLoS One. 6, e27396.

  8. Jin, T., Curry, J., Smith, P., Jiang, J., and Xiao, T. S. (2013) Structure of the NLRP1 Caspase Recruitment Domain Suggests Potential Mechanisms for its Association with Procaspase-1. Proteins. 81, 1266-1270.

  9. Nour, A. M., Yeung, Y. G., Santambrogio, L., Boyden, E. D., Stanley, E. R., and Brojatsch, J. (2009) Anthrax Lethal Toxin Triggers the Formation of a Membrane-Associated Inflammasome Complex in Murine Macrophages. Infect Immun. 77, 1262-1271.

  10. Ewald, S. E., Chavarria-Smith, J., and Boothroyd, J. C. (2014) NLRP1 is an Inflammasome Sensor for Toxoplasma Gondii. Infect Immun. 82, 460-468.

  11. Gorfu, G., Cirelli, K. M., Melo, M. B., Mayer-Barber, K., Crown, D., Koller, B. H., Masters, S., Sher, A., Leppla, S. H., Moayeri, M., Saeij, J. P., and Grigg, M. E. (2014) Dual Role for Inflammasome Sensors NLRP1 and NLRP3 in Murine Resistance to Toxoplasma Gondii. MBio. 5, 10.1128/mBio.01117-13.

  12. Liao, K. C., and Mogridge, J. (2013) Activation of the Nlrp1b Inflammasome by Reduction of Cytosolic ATP. Infect Immun. 81, 570-579.

  13. Grandemange, S., Sanchez, E., Louis-Plence, P., Tran Mau-Them, F., Bessis, D., Coubes, C., Frouin, E., Seyger, M., Girard, M., Puechberty, J., Costes, V., Rodiere, M., Carbasse, A., Jeziorski, E., Portales, P., Sarrabay, G., Mondain, M., Jorgensen, C., Apparailly, F., Hoppenreijs, E., Touitou, I., and Genevieve, D. (2017) A New Autoinflammatory and Autoimmune Syndrome Associated with NLRP1 Mutations: NAIAD (NLRP1-Associated Autoinflammation with Arthritis and Dyskeratosis). Ann Rheum Dis. 76, 1191-1198.

  14. Soler, V. J., Tran-Viet, K. N., Galiacy, S. D., Limviphuvadh, V., Klemm, T. P., St Germain, E., Fournie, P. R., Guillaud, C., Maurer-Stroh, S., Hawthorne, F., Suarez, C., Kantelip, B., Afshari, N. A., Creveaux, I., Luo, X., Meng, W., Calvas, P., Cassagne, M., Arne, J. L., Rozen, S. G., Malecaze, F., and Young, T. L. (2013) Whole Exome Sequencing Identifies a Mutation for a Novel Form of Corneal Intraepithelial Dyskeratosis. J Med Genet. 50, 246-254.

  15. Zhong, F. L., Mamai, O., Sborgi, L., Boussofara, L., Hopkins, R., Robinson, K., Szeverenyi, I., Takeichi, T., Balaji, R., Lau, A., Tye, H., Roy, K., Bonnard, C., Ahl, P. J., Jones, L. A., Baker, P., Lacina, L., Otsuka, A., Fournie, P. R., Malecaze, F., Lane, E. B., Akiyama, M., Kabashima, K., Connolly, J. E., Masters, S. L., Soler, V. J., Omar, S. S., McGrath, J. A., Nedelcu, R., Gribaa, M., Denguezli, M., Saad, A., Hiller, S., and Reversade, B. (2016) Germline NLRP1 Mutations Cause Skin Inflammatory and Cancer Susceptibility Syndromes Via Inflammasome Activation. Cell. 167, 187-202.e17.

  16. Jin, Y., Mailloux, C. M., Gowan, K., Riccardi, S. L., LaBerge, G., Bennett, D. C., Fain, P. R., and Spritz, R. A. (2007) NALP1 in Vitiligo-Associated Multiple Autoimmune Disease. N Engl J Med. 356, 1216-1225.

  17. Masters, S. L., Gerlic, M., Metcalf, D., Preston, S., Pellegrini, M., O'Donnell, J. A., McArthur, K., Baldwin, T. M., Chevrier, S., Nowell, C. J., Cengia, L. H., Henley, K. J., Collinge, J. E., Kastner, D. L., Feigenbaum, L., Hilton, D. J., Alexander, W. S., Kile, B. T., and Croker, B. A. (2012) NLRP1 Inflammasome Activation Induces Pyroptosis of Hematopoietic Progenitor Cells. Immunity. 37, 1009-1023.