Phenotypic Mutation 'Gregory'

• Allele: Gregory
• Mutation Type: critical splice donor site
• Chromosome: 10
• Coordinate: 99,912,768 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Kitl
• Gene Name: kit ligand
• Synonym(s): blz, Mgf, SLF, SF, Kitlg, Steel factor, stem cell factor, Steel, Sl, SCF, Gb, grizzle-belly
• Chromosomal Location: 99,851,492-99,936,278 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020129 ^†] [ENSMUSP00000100920 ^†] [ENSMUSP00000123360] [ENSMUSP00000151554] † probably from a misspliced transcript
• AlphaFold: P20826
• PDB Structure: Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION] ; Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000020129; Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	1	176	5.7e-102	PFAM
Pfam:SCF	173	245	1.7e-36	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000100920; Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	1	273	2.3e-157	PFAM

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000123360; Gene: ENSMUSG00000019966

Domain	Start	End	E-Value	Type
Pfam:SCF	43	160	1.1e-69	PFAM

• Predicted Effect: probably benign
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9479
• Is this an essential gene?: Probably nonessential (E-score: 0.205)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2019-10-23 1:57 PM by Anne Murray
• Record Created: 2017-11-22 1:46 PM by Dana Smith
• Record Posted: 2018-08-06
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Dana Smith, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_013598, NM_001347156; MGI:96974

Alleles Listed at MGI

All Mutations and Alleles(79) : Chemically and radiation induced(8) Chemically induced (ENU)(15) Chemically induced (other)(1) Gene trapped(4) Radiation induced(15) Spontaneous(21) Targeted(10) Transgenic(5)

Phenotypic Description

Figure 1. Gregory mice showed grey and white fur on their abdomens.

The Gregory phenotype was identified among G3 mice of the pedigree R6138, some of which showed grey and white fur on their abdomens (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the pigmentation phenotype using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 30 mutations (X-axis) identified in the G1 male of pedigree R6138. Binary data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 30 mutations. The pigmentation phenotype was linked to a mutation in Kitl:  a G to A transition at base pair 100,076,906 (v38) on chromosome 10, or base pair 61,272 in the GenBank genomic region NC_000076 within the splice donor site of intron 4 (1-base pair from exon 4). The strongest association was found with a dominant model of inheritance (P = 1.18 x 10^-11), wherein 40 affected mice were heterozygous for the variant allele, and 25 unaffected mice were homozygous for the reference allele (Figure 2); no homozygous variant mice were born to pedigree R6138.

The effect of the mutation at the cDNA and protein levels has not been examined.

<--exon 3 <--exon 4 intron 4--> exon 5--> 381 ……ATGGATGTTTTG ……AACGCACCGAAG gtaacttggtattcatcag…… AATATAAAAGAA…… 61  ……-M--D--V--L- ……-N--A--P--K-                       -N--I--K--E-……

The donor splice site of intron 4, which is destroyed by the Gregory mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain structure of SCF. The gregory mutation results in a G to A transition within the splice donor site of intron 4. The location of other Kitl mutations is indicated; click to view more information about these mutations. Abbreviations: SP, signal peptide; TM, transmembrane domain.

Kitl encodes stem cell factor (SCF; alternatively, Kit ligand [KL], Steel, Steel factor, or mast cell growth factor [MGF]). SCF has an N-terminal signal sequence and a putative transmembrane domain near the C-terminus [Figure 3; (1)]. Kitl undergoes alternatively splicing to form two protein products: SCF-M1 and SCF-M2 (2;3). SCF-M1 has the major proteolytic cleavage site that generates soluble SCF, while SCF-M2 does not have the major proteolytic site (3). Soluble SCF consists of a region of the protein between the signal sequence and the transmembrane domain. Soluble SCF mediates cell migration, while the membrane-bound SCF mediates cell survival (4;5).

The gregory mutation is within the splice donor site of intron 4, which corresponds to an area within the soluble SCF region. The effect of the mutation at the cDNA and protein levels has not been examined.

Please see the record mooyah for more information about Kitl.

Putative Mechanism

SCF functions as a noncovalent homodimer to activate KIT [see the record for Pretty2; (6-9)]. SCF/KIT-associated signaling mediates hematopoiesis, melanogenesis, and gametogenesis (1;10).

Mutations in KITL (alternatively, KITLG) in humans are associated with unilateral or asymmetric autosomal dominant deafness-69 [OMIM: #616697; (11)], familial progressive hyperpigmentation with or without hypopigmentation [FPHH; OMIM: #145250; (12;13)], and skin/hair/eye pigmentation-7, blond/brown hair [OMIM: #611664; (14;15)]. Patients with FPHH exhibit diffuse hyperpigmentation of variable intensity sometimes associated with cafe-au-lait macules and larger hypopigmented ash-leaf macules. Loss-of-function mutations in KIT result in piebaldism (16) (OMIM #172800), an autosomal dominant disease characterized by a white forelock and large, non-pigmented patches on the forehead, eyebrows, chin, chest, abdomen and extremities.

Kitl knockout and mutant mouse models (MGI) exhibit variable hypopigmentation and/or white spotting of the fur, abnormal foot and ear pigmentation, and normal eye pigmentation (6;17-26). Some models also exhibited reduced body weights, reduced male and female fertility, reduced numbers of primordial germ cells, macrocytic anemia, decreased hematocrit, reduced numbers of erythrocytes and mast cells, reduced hemoglobin content, increased mean corpuscular hemoglobin, increased mean corpuscular volume, reduced bone mineral content and density, thymus atrophy, progressive ulcerative dermatitis, and increased incidence of testicular teratomas (6;17;18;20;21;23;24;26-37)). Some mutations also resulted in pre-, peri- or postnatal lethality [MGI; (20;21;27;28;29;36;38)].

The gregory mutation is not predicted to affect the cleavage of SCF, but may reduce the amount of SCF on the cell surface (39-42). Reduced cell surface expression of SCF results in reduced numbers of SCF-dependent mastocytes, germ cells, and melanocytes.

Primers

PCR Primer
Gregory_pcr_F: GTGCTGAGAGACTTGAAGAGCC
Gregory_pcr_R: GCCACTTCAGTATTGCAGTAAAAC

Sequencing Primer
Gregory_seq_F: TTGAAGAGCCCCCTGAATCTG
Gregory_seq_R: TGCAGTAAAACTACAATAGACTCTTG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 431 nucleotides is amplified (chromosome 10, + strand):

1   gtgctgagag acttgaagag ccccctgaat ctgccatagt tataatagat acttttgtct
61  tctctttgaa tttcttccag cctagtcatt gttggctacg agatatggta atacaattat
121 cactcagctt gactactctt ctggacaagt tctcaaatat ttctgaaggc ttgagtaatt
181 actccatcat agacaaactt gggaaaatag tggatgacct cgtgttatgc atggaagaaa
241 acgcaccgaa ggtaacttgg tattcatcag aattgttctt ttcttatact tctctaagac
301 ctttcctaag caatggtatt gggaagatga gagcctcctt gttttgtgtt attttaaact
361 ataaactttt atttaattta aggatagttt aacaagagtc tattgtagtt ttactgcaat
421 actgaagtgg c

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K. H., Morris, C. F., McNiece, I. K., Jacobsen, F. W., and Mendiaz, E. A. (1990) Primary Structure and Functional Expression of Rat and Human Stem Cell Factor DNAs. Cell. 63, 203-211.

  2. Huang, E. J., Nocka, K. H., Buck, J., and Besmer, P. (1992) Differential Expression and Processing of Two Cell Associated Forms of the Kit-Ligand: KL-1 and KL-2. Mol Biol Cell. 3, 349-362.

  3. Flanagan, J. G., Chan, D. C., and Leder, P. (1991) Transmembrane Form of the Kit Ligand Growth Factor is Determined by Alternative Splicing and is Missing in the Sld Mutant. Cell. 64, 1025-1035.

  4. Tajima, Y., Moore, M. A., Soares, V., Ono, M., Kissel, H., and Besmer, P. (1998) Consequences of Exclusive Expression in Vivo of Kit-Ligand Lacking the Major Proteolytic Cleavage Site. Proc Natl Acad Sci U S A. 95, 11903-11908.

  5. Wehrle-Haller, B., and Weston, J. A. (1995) Soluble and Cell-Bound Forms of Steel Factor Activity Play Distinct Roles in Melanocyte Precursor Dispersal and Survival on the Lateral Neural Crest Migration Pathway. Development. 121, 731-742.

  6. Huang, E. J., Nocka, K. H., Buck, J., and Besmer, P. (1992) Differential Expression and Processing of Two Cell Associated Forms of the Kit-Ligand: KL-1 and KL-2. Mol Biol Cell. 3, 349-362.

  7. Huang, E., Nocka, K., Beier, D. R., Chu, T. Y., Buck, J., Lahm, H. W., Wellner, D., Leder, P., and Besmer, P. (1990) The Hematopoietic Growth Factor KL is Encoded by the Sl Locus and is the Ligand of the c-Kit Receptor, the Gene Product of the W Locus. Cell. 63, 225-233.

  8. Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K. H., Morris, C. F., McNiece, I. K., Jacobsen, F. W., Mendiaz, E. A., et al. (1990) Primary Structure and Functional Expression of Rat and Human Stem Cell Factor DNAs. Cell. 63, 203-211.

  9. Williams, D. E., Eisenman, J., Baird, A., Rauch, C., Van, N. K., March, C. J., Park, L. S., Martin, U., Mochizuki, D. Y., Boswell, H. S., et al. (1990) Identification of a Ligand for the c-Kit Proto-Oncogene. Cell. 63, 167-174.

  10. Besmer, P., Manova, K., Duttlinger, R., Huang, E. J., Packer, A., Gyssler, C., and Bachvarova, R. F. (1993) The Kit-Ligand (Steel Factor) and its Receptor c-kit/W: Pleiotropic Roles in Gametogenesis and Melanogenesis. Dev Suppl. , 125-137.

  11. Zazo Seco, C., Serrao de Castro, L., van Nierop, J. W., Morin, M., Jhangiani, S., Verver, E. J., Schraders, M., Maiwald, N., Wesdorp, M., Venselaar, H., Spruijt, L., Oostrik, J., Schoots, J., Baylor-Hopkins Center for Mendelian Genomics, van Reeuwijk, J., Lelieveld, S. H., Huygen, P. L., Insenser, M., Admiraal, R. J., Pennings, R. J., Hoefsloot, L. H., Arias-Vasquez, A., de Ligt, J., Yntema, H. G., Jansen, J. H., Muzny, D. M., Huls, G., van Rossum, M. M., Lupski, J. R., Moreno-Pelayo, M. A., Kunst, H. P., and Kremer, H. (2015) Allelic Mutations of KITLG, Encoding KIT Ligand, Cause Asymmetric and Unilateral Hearing Loss and Waardenburg Syndrome Type 2. Am J Hum Genet. 97, 647-660.

  12. Wang, Z. Q., Si, L., Tang, Q., Lin, D., Fu, Z., Zhang, J., Cui, B., Zhu, Y., Kong, X., Deng, M., Xia, Y., Xu, H., Le, W., Hu, L., and Kong, X. (2009) Gain-of-Function Mutation of KIT Ligand on Melanin Synthesis Causes Familial Progressive Hyperpigmentation. Am J Hum Genet. 84, 672-677.

  13. Amyere, M., Vogt, T., Hoo, J., Brandrup, F., Bygum, A., Boon, L., and Vikkula, M. (2011) KITLG Mutations Cause Familial Progressive Hyper- and Hypopigmentation. J Invest Dermatol. 131, 1234-1239.

  14. Sulem, P., Gudbjartsson, D. F., Stacey, S. N., Helgason, A., Rafnar, T., Magnusson, K. P., Manolescu, A., Karason, A., Palsson, A., Thorleifsson, G., Jakobsdottir, M., Steinberg, S., Palsson, S., Jonasson, F., Sigurgeirsson, B., Thorisdottir, K., Ragnarsson, R., Benediktsdottir, K. R., Aben, K. K., Kiemeney, L. A., Olafsson, J. H., Gulcher, J., Kong, A., Thorsteinsdottir, U., and Stefansson, K. (2007) Genetic Determinants of Hair, Eye and Skin Pigmentation in Europeans. Nat Genet. 39, 1443-1452.

  15. Miller, C. T., Beleza, S., Pollen, A. A., Schluter, D., Kittles, R. A., Shriver, M. D., and Kingsley, D. M. (2007) Cis-Regulatory Changes in Kit Ligand Expression and Parallel Evolution of Pigmentation in Sticklebacks and Humans. Cell. 131, 1179-1189.

  16. Giebel, L. B., and Spritz, R. A. (1991) Mutation of the KIT (mast/stem Cell Growth Factor Receptor) Protooncogene in Human Piebaldism. Proc Natl Acad Sci U S A. 88, 8696-8699.

  17. Graw, J., Loster, J., Neuhauser-Klaus, A., Pretsch, W., and Schmitt-John, T. (1996) Molecular Analysis of Two New Steel Mutations in Mice shows a Transversion Or an Insertion. Mamm Genome. 7, 843-846.

  18. Graw, J., Neuhauser-Klaus, A., and Pretsch, W. (1997) Detection of a Point Mutation (A to G) in Exon 5 of the Murine Mgf Gene Defines a Novel Allele at the Steel Locus with a Weak Phenotype. Mutat Res. 382, 75-78.

  19. Kuroda, H., Terada, N., Nakayama, H., Matsumoto, K., and Kitamura, Y. (1988) Infertility due to Growth Arrest of Ovarian Follicles in Sl/Slt Mice. Dev Biol. 126, 71-79.

  20. Chandra, S., Kapur, R., Chuzhanova, N., Summey, V., Prentice, D., Barker, J., Cooper, D. N., and Williams, D. A. (2003) A Rare Complex DNA Rearrangement in the Murine Steel Gene Results in Exon Duplication and a Lethal Phenotype. Blood. 102, 3548-3555.

  21. Rajaraman, S., Davis, W. S., Mahakali-Zama, A., Evans, H. K., Russell, L. B., and Bedell, M. A. (2002) An Allelic Series of Mutations in the Kit Ligand Gene of Mice. II. Effects of Ethylnitrosourea-Induced Kitl Point Mutations on Survival and Peripheral Blood Cells of Kitl(Steel) Mice. Genetics. 162, 341-353.

  22. Nolan, P. M., Peters, J., Strivens, M., Rogers, D., Hagan, J., Spurr, N., Gray, I. C., Vizor, L., Brooker, D., Whitehill, E., Washbourne, R., Hough, T., Greenaway, S., Hewitt, M., Liu, X., McCormack, S., Pickford, K., Selley, R., Wells, C., Tymowska-Lalanne, Z., Roby, P., Glenister, P., Thornton, C., Thaung, C., Stevenson, J. A., Arkell, R., Mburu, P., Hardisty, R., Kiernan, A., Erven, A., Steel, K. P., Voegeling, S., Guenet, J. L., Nickols, C., Sadri, R., Nasse, M., Isaacs, A., Davies, K., Browne, M., Fisher, E. M., Martin, J., Rastan, S., Brown, S. D., and Hunter, J. (2000) A Systematic, Genome-Wide, Phenotype-Driven Mutagenesis Programme for Gene Function Studies in the Mouse. Nat Genet. 25, 440-443.

  23. Bedell, M. A., Brannan, C. I., Evans, E. P., Copeland, N. G., Jenkins, N. A., and Donovan, P. J. (1995) DNA Rearrangements Located Over 100 Kb 5' of the Steel (Sl)-Coding Region in Steel-Panda and Steel-Contrasted Mice Deregulate Sl Expression and Cause Female Sterility by Disrupting Ovarian Follicle Development. Genes Dev. 9, 455-470.

  24. Brannan, C. I., Lyman, S. D., Williams, D. E., Eisenman, J., Anderson, D. M., Cosman, D., Bedell, M. A., Jenkins, N. A., and Copeland, N. G. (1991) Steel-Dickie Mutation Encodes a c-Kit Ligand Lacking Transmembrane and Cytoplasmic Domains. Proc Natl Acad Sci U S A. 88, 4671-4674.

  25. Kohrogi, T., Yokoyama, M., Taguchi, T., Kitamura, Y., and Tutikawa, K. (1983) Effect of the Slt Mutant Allele on the Production of Tissue Mast Cells in Mice. J Hered. 74, 375-377.

  26. Deshpande, S., Agosti, V., Manova, K., Moore, M. A., Hardy, M. P., and Besmer, P. (2010) Kit Ligand Cytoplasmic Domain is Essential for Basolateral Sorting in Vivo and has Roles in Spermatogenesis and Hematopoiesis. Dev Biol. 337, 199-210.

  27. Kales, A. N., Fried, W., and Gurney, C. W. (1966) Mechanism of the Hereditary Anemia of Slm Mutant Mice. Blood. 28, 387-397.

  28. Mahakali Zama, A., Hudson, F. P.,3rd, and Bedell, M. A. (2005) Analysis of Hypomorphic KitlSl Mutants Suggests Different Requirements for KITL in Proliferation and Migration of Mouse Primordial Germ Cells. Biol Reprod. 73, 639-647.

  29. Rajaraman, S., Wood, L. K., Willhite, D. K., Russell, L. B., and Bedell, M. A. (2003) Effects of Spontaneous KitlSteel Mutations on Survival and Red Blood Cells of Mice. Mamm Genome. 14, 168-174.

  30. Bedell, M. A., Cleveland, L. S., O'Sullivan, T. N., Copeland, N. G., and Jenkins, N. A. (1996) Deletion and Interallelic Complementation Analysis of Steel Mutant Mice. Genetics. 142, 935-944.

  31. Brannan, C. I., Bedell, M. A., Resnick, J. L., Eppig, J. J., Handel, M. A., Williams, D. E., Lyman, S. D., Donovan, P. J., Jenkins, N. A., and Copeland, N. G. (1992) Developmental Abnormalities in Steel17H Mice Result from a Splicing Defect in the Steel Factor Cytoplasmic Tail. Genes Dev. 6, 1832-1842.

  32. Kitamura, Y., and Go, S. (1979) Decreased Production of Mast Cells in S1/S1d Anemic Mice. Blood. 53, 492-497.

  33. Lotinun, S., Evans, G. L., Turner, R. T., and Oursler, M. J. (2005) Deletion of Membrane-Bound Steel Factor Results in Osteopenia in Mice. J Bone Miner Res. 20, 644-652.

  34. Sundberg, J. P., Kenty, G. A., Beamer, W. G., and Adkison, D. L. (1992) Forestomach Papillomas in Flaky Skin and Steel-Dickie Mutant Mice. J Vet Diagn Invest. 4, 312-317.

  35. McCoshen, J. A., and McCallion, D. J. (1975) A Study of the Primordial Germ Cells during their Migratory Phase in Steel Mutant Mice. Experientia. 31, 589-590.

  36. Sarvella, P. A., and Russell, L. B. (1956) Steel, a New Dominant Gene in the House Mouse. J Hered. 47, 123-128.

  37. Stevens, L. C., and Mackensen, J. A. (1961) Genetic and Environmental Influences on Teratocarcinogenesis in Mice. J Natl Cancer Inst. 27, 443-453.

  38. Murphy, E. D. (1977) Effects of Mutant Steel Alleles on Leukemogenesis and Life-Span in the Mouse. J Natl Cancer Inst. 58, 107-110.

  39. Cheng, H. J., and Flanagan, J. G. (1994) Transmembrane Kit Ligand Cleavage does Not Require a Signal in the Cytoplasmic Domain and Occurs at a Site Dependent on Spacing from the Membrane. Mol Biol Cell. 5, 943-953.

  40. Tajima, Y., Huang, E. J., Vosseller, K., Ono, M., Moore, M. A., and Besmer, P. (1998) Role of Dimerization of the Membrane-Associated Growth Factor Kit Ligand in Juxtacrine Signaling: The Sl17H Mutation Affects Dimerization and Stability-Phenotypes in Hematopoiesis. J Exp Med. 187, 1451-1461.

  41. Wehrle-Haller, B., and Weston, J. A. (1999) Altered Cell-Surface Targeting of Stem Cell Factor Causes Loss of Melanocyte Precursors in Steel17H Mutant Mice. Dev Biol. 210, 71-86.

  42. Paulhe, F., Imhof, B. A., and Wehrle-Haller, B. (2004) A Specific Endoplasmic Reticulum Export Signal Drives Transport of Stem Cell Factor (Kitl) to the Cell Surface. J Biol Chem. 279, 55545-55555.