Phenotypic Mutation 'gregory' (pdf version)
List |< first << previous [record 15 of 74] next >> last >|
Allelegregory
Mutation Type critical splice donor site
Chromosome10
Coordinate100,076,906 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Kitl
Gene Name kit ligand
Synonym(s) Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
Chromosomal Location 100,015,630-100,100,416 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_013598, NM_001347156; MGI:96974

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020129] [ENSMUSP00000100920] [ENSMUSP00000123360] [ENSMUSP00000151554]
PDB Structure
Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
Blood Pressure: DBP Average - increased
Blood Pressure: DBP Day 3 - increased
Blood Pressure: MBP Average - increased
Blood Pressure: MBP Day 2 - increased
Blood Pressure: MBP Day 3 - increased
Blood Pressure: SBP Average - increased
pigmentation
skin/coat/nails
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(79) : Chemically and radiation induced(8) Chemically induced (ENU)(15) Chemically induced (other)(1) Gene trapped(4) Radiation induced(15) Spontaneous(21) Targeted(10) Transgenic(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
mooyah UTSW 10 100088222 critical splice donor site probably null
sandycheeks UTSW 10 100076906 critical splice donor site
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R1649:Kitl UTSW 10 100064114 missense probably benign 0.03
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5135:Kitl UTSW 10 100088222 critical splice donor site probably null
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5832:Kitl UTSW 10 100080020 missense probably damaging 1.00
R5971:Kitl UTSW 10 100076906 critical splice donor site probably null
R6043:Kitl UTSW 10 100064085 missense probably damaging 1.00
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2018-08-06 2:01 PM by Anne Murray
Record Created 2017-11-22 1:46 PM by Dana Smith
Record Posted 2018-08-06
Phenotypic Description
Figure 1. Gregory mice showed grey and white fur on their abdomens.

The Gregory phenotype was identified among G3 mice of the pedigree R6138, some of which showed grey and white fur on their abdomens (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the pigmentation phenotype using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 30 mutations (X-axis) identified in the G1 male of pedigree R6138. Binary data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 30 mutations. The pigmentation phenotype was linked to a mutation in Kitl:  a G to A transition at base pair 100,076,906 (v38) on chromosome 10, or base pair 61,272 in the GenBank genomic region NC_000076 within the splice donor site of intron 4 (1-base pair from exon 4). The strongest association was found with a dominant model of inheritance (P = 1.18 x 10-11), wherein 40 affected mice were heterozygous for the variant allele, and 25 unaffected mice were homozygous for the reference allele (Figure 2); no homozygous variant mice were born to pedigree R6138.

 

The effect of the mutation at the cDNA and protein levels has not been examined.

 

         <--exon 3      <--exon 4 intron 4-->           exon 5-->
381 ……ATGGATGTTTTG ……AACGCACCGAAG gtaacttggtattcatcag…… AATATAAAAGAA……
61  ……-M--D--V--L- ……-N--A--P--K-                       -N--I--K--E-……

 

The donor splice site of intron 4, which is destroyed by the Gregory mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction

Figure 3. Domain structure of SCF. The gregory mutation results in a G to A transition within the splice donor site of intron 4. The location of other Kitl mutations is indicated; click to view more information about these mutations. Abbreviations: SP, signal peptide; TM, transmembrane domain.

Kitl encodes stem cell factor (SCF; alternatively, Kit ligand [KL], Steel, Steel factor, or mast cell growth factor [MGF]). SCF has an N-terminal signal sequence and a putative transmembrane domain near the C-terminus [Figure 3; (1)]. Kitl undergoes alternatively splicing to form two protein products: SCF-M1 and SCF-M2 (2;3). SCF-M1 has the major proteolytic cleavage site that generates soluble SCF, while SCF-M2 does not have the major proteolytic site (3). Soluble SCF consists of a region of the protein between the signal sequence and the transmembrane domain. Soluble SCF mediates cell migration, while the membrane-bound SCF mediates cell survival (4;5).

 

The gregory mutation is within the splice donor site of intron 4, which corresponds to an area within the soluble SCF region. The effect of the mutation at the cDNA and protein levels has not been examined.

 

Please see the record mooyah for more information about Kitl.

Putative Mechanism

SCF functions as a noncovalent homodimer to activate KIT [see the record for Pretty2; (6-9)]. SCF/KIT-associated signaling mediates hematopoiesis, melanogenesis, and gametogenesis (1;10).

 

Mutations in KITL (alternatively, KITLG) in humans are associated with unilateral or asymmetric autosomal dominant deafness-69 [OMIM: #616697; (11)], familial progressive hyperpigmentation with or without hypopigmentation [FPHH; OMIM: #145250; (12;13)], and skin/hair/eye pigmentation-7, blond/brown hair [OMIM: #611664; (14;15)]. Patients with FPHH exhibit diffuse hyperpigmentation of variable intensity sometimes associated with cafe-au-lait macules and larger hypopigmented ash-leaf macules. Loss-of-function mutations in KIT result in piebaldism (16) (OMIM #172800), an autosomal dominant disease characterized by a white forelock and large, non-pigmented patches on the forehead, eyebrows, chin, chest, abdomen and extremities.

 

Kitl knockout and mutant mouse models (MGI) exhibit variable hypopigmentation and/or white spotting of the fur, abnormal foot and ear pigmentation, and normal eye pigmentation (6;17-26). Some models also exhibited reduced body weights, reduced male and female fertility, reduced numbers of primordial germ cells, macrocytic anemia, decreased hematocrit, reduced numbers of erythrocytes and mast cells, reduced hemoglobin content, increased mean corpuscular hemoglobin, increased mean corpuscular volume, reduced bone mineral content and density, thymus atrophy, progressive ulcerative dermatitis, and increased incidence of testicular teratomas (6;17;18;20;21;23;24;26-37)). Some mutations also resulted in pre-, peri- or postnatal lethality [MGI; (20;21;27;28;29;36;38)].

 

The gregory mutation is not predicted to affect the cleavage of SCF, but may reduce the amount of SCF on the cell surface (39-42). Reduced cell surface expression of SCF results in reduced numbers of SCF-dependent mastocytes, germ cells, and melanocytes.

Primers PCR Primer
gregory(F):5'- GTGCTGAGAGACTTGAAGAGCC -3'
gregory(R):5'- GCCACTTCAGTATTGCAGTAAAAC -3'

Sequencing Primer
gregory_seq(F):5'- TTGAAGAGCCCCCTGAATCTG -3'
gregory_seq(R):5'- TGCAGTAAAACTACAATAGACTCTTG -3'
References
  36. Sarvella, P. A., and Russell, L. B. (1956) Steel, a New Dominant Gene in the House Mouse. J Hered. 47, 123-128.
  37. Stevens, L. C., and Mackensen, J. A. (1961) Genetic and Environmental Influences on Teratocarcinogenesis in Mice. J Natl Cancer Inst. 27, 443-453.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsDana Smith, Jamie Russell, and Bruce Beutler
List |< first << previous [record 15 of 74] next >> last >|