Phenotypic Mutation 'goku'

• Allele: goku
• Mutation Type: nonsense
• Chromosome: 15
• Coordinate: 11,000,941 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Slc45a2
• Gene Name: solute carrier family 45, member 2
• Synonym(s): Aim1, Dbr, blanc-sale, dominant brown, Aim-1, Matp, bls, Oca4
• Chromosomal Location: 11,000,807-11,029,319 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transporter protein that mediates melanin synthesis. The protein is expressed in a high percentage of melanoma cell lines. Mutations in this gene are a cause of oculocutaneous albinism type 4, and polymorphisms in this gene are associated with variations in skin and hair color. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] ; PHENOTYPE: Homozygotes for spontaneous mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and hair, especially the underfur. Eyes are very light at birth but darken with age. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Stop codon
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000112408]
• AlphaFold: P58355
• SMART Domains: Protein: ENSMUSP00000022851; Gene: ENSMUSG00000022243; AA Change: Y13*

Domain	Start	End	E-Value	Type
Pfam:MFS_2	34	262	2.4e-17	PFAM
Pfam:MFS_1	36	363	3e-13	PFAM
transmembrane domain	365	387	N/A	INTRINSIC
transmembrane domain	394	416	N/A	INTRINSIC
transmembrane domain	421	443	N/A	INTRINSIC
transmembrane domain	477	499	N/A	INTRINSIC
transmembrane domain	504	526	N/A	INTRINSIC

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000112408; Gene: ENSMUSG00000022243; AA Change: Y13*

Domain	Start	End	E-Value	Type
Pfam:MFS_2	1	457	2e-22	PFAM
Pfam:MFS_1	2	292	2.6e-12	PFAM

• Predicted Effect: probably null
• Meta Mutation Damage Score: 0.9485
• Is this an essential gene?: Probably nonessential (E-score: 0.094)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2019-09-04 9:38 PM by Anne Murray
• Record Created: 2017-12-04 11:25 AM by Dana Smith
• Record Posted: 2018-08-02
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Dana Smith, Brittney Roy, Jamie Russell, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_053077; MGI: 2153040

Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(11) Spontaneous(7) Targeted(3)

Phenotypic Description

Figure 1. The goku mice exhibit hypopigmentation of the fur . A wild-type littermate is shown for reference.

The goku phenotype was identified among G3 mice of the pedigree R5896, some of which showed hypopigmentation of the fur (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the hypopigmentation phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 76 mutations (X-axis) identified in the G1 male of pedigree R5896. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 76 mutations. The pigmentation phenotype was linked to a mutation Slc45a2: a T to A transversion at base pair 11,000,855 (v38) on chromosome 15, or base pair 135 in the GenBank genomic region NC_000081 encoding Slc45a2. Linkage was found with a recessive model of inheritance (P = 6.661 x 10^-16), wherein 15 affected mice were homozygous for the variant allele, and 68 unaffected mice were either heterozygous (N = 44) or homozygous for the reference allele (N = 24) (Figure 3)

The mutation corresponds to residue 135 in the mRNA sequence NM_053077 within exon 1 of 7 total exons.

118 ACTGACACCCATACCTATCAATCCTTAGCCGAG 8   -T--D--T--H--T--Y--Q--S--L--A--E-

The mutated nucleotide is indicated in red. The mutation results in substitution of tyrosine 13 for a premature stop codon (Y13*) in the SLC45A2 protein.

Protein Prediction

Figure 3. Protein topology and domain structure of SLC45A2. SLC45A2 is a 55kD protein with 12 membrane-spanning (TM) domains, an elongated N-terminus, and enlarged cytoplasmic loop between transmembrane domains six and seven. The sucrose-transporter signature sequence, R-W-G-R-R is noted. The goku mutation (red asterisk) causes substitution of tyrosine 13 for a premature stop codon. This image is interactive. Click on the mutations for more specific information.  

The goku mutation occurs within the N-terminal tail preceding the first transmembrane domain (Figure 3). The function of the N-terminus is unknown. The cytoplasmic N-terminus of SLC45A2 (amino acids 1-45) does not contain any defined domains (UniProt) or post-translational modifications. However, SMART defines a Major Facilitator Superfamily (MFS)_1 Pfam domain, a domain shared by carriers that transport small solutes, consisting of amino acids 36-364. 

Please see the record cardigan for information about Slc45a2.

Putative Mechanism

Homozygous mice with Slc45a2 mutations exhibit varied degrees of hypopigmentation of the eyes, skin, and fur (1). In addition, mutations in SLC45A2 can cause oculocutaneous albinism, type IV (OCA4; OMIM: #606574). Mutations at or near the cytoplasmic N-terminus have not been documented in either mouse or human. Expression of SLC45A2^goku has not been examined, but the hypopigmentation phenotype resembles that of the proposed null mutant cardigan, indicating loss of SLC45A2 expression in goku. 

Primers

PCR Primer
goku_pcr_F: TCTGTCATGCTTCCGAGTG
goku_pcr_R: CTGTACAGGCTCTTAGGCAG

Sequencing Primer
goku_seq_F: ATGCTTCCGAGTGCCAAC
goku_seq_R: TCTTAGGCAGGCCCACG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 15, + strand):

1   tctgtcatgc ttccgagtgc caacgccccc tttgcttctc accgtaactt gtgatcttgg
61  aggcatgaaa gaatttcagc ccctcctcca gcctgaccat ctctgttggt tgctctgaca
121 ggctccatgt cagacccggt ttggagcaca aatctgagga ccacgcaaga aggctatttt
181 ctccgtggtc atgagtggaa gcaatgggcc gactgacacc catacctatc aatccttagc
241 cgaggattgc ccctttggct ctgtggagca acccaagaga tccacaggga gacttgtcat
301 gcacagcatg gccatgtttg gccgagagtt ttgctatgcg gtggaggcag cttatgtgac
361 tccagttctg ctcagcgtgg gcctgcctaa gagcctgtac ag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Sweet, H. O., Brilliant, M. H., Cook, S. A., Johnson, K. R., and Davisson, M. T. (1998) A New Allelic Series for the Underwhite Gene on Mouse Chromosome 15. J Hered. 89, 546-551.